View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14806_low_5 (Length: 342)
Name: NF14806_low_5
Description: NF14806
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14806_low_5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 226; Significance: 1e-124; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 7 - 281
Target Start/End: Original strand, 10055590 - 10055864
Alignment:
| Q |
7 |
ggttttacctcagcgattgagataaacatggcaattctcgttttgtttatgatttattcctattgacttaagggttccatttgcatgttggcaatttttt |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
10055590 |
ggttttacctcagcgattgagataaacatggcaattctcgttttgtttatgatttattcctattgacttaagggttctatttgcatgttggcaatttttt |
10055689 |
T |
 |
| Q |
107 |
ggtaaacatttgcaagttggtgattaattaatgcaagataaagctaactaagtaccccattcgtacatatcgtaaaccaaatttaacgagtgcaacgttg |
206 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10055690 |
ggcaaacatttgcaagttggtgattaattaatgcaagataaagctaactaagta--ccattcgtacatatcgtaaaccaaatttaacgagtgcaacgttg |
10055787 |
T |
 |
| Q |
207 |
gcacttcattnnnnnnnctgatccagggacaattgcttaacaaactaaca--ctcagtgtcaaattctacgtcattg |
281 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
10055788 |
gcacttcattaaaaaaactgatccagggacaattgcttaacaaactaacactctcagtgtcaaattctacgtcattg |
10055864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 306 - 342
Target Start/End: Original strand, 10056869 - 10056905
Alignment:
| Q |
306 |
cattttaagatagcaatgaaacattaatgtttctttt |
342 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10056869 |
cattttaagatagcaatgaaacattaatgtttctttt |
10056905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University