View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14806_low_8 (Length: 301)
Name: NF14806_low_8
Description: NF14806
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14806_low_8 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 31; Significance: 0.00000003; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 104 - 134
Target Start/End: Complemental strand, 38346608 - 38346578
Alignment:
| Q |
104 |
taagggatctctagttaaatatccctaaaag |
134 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
38346608 |
taagggatctctagttaaatatccctaaaag |
38346578 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 228 - 260
Target Start/End: Complemental strand, 38346480 - 38346448
Alignment:
| Q |
228 |
atagtagtgtaaaatgtataccaacaaaatgat |
260 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| |
|
|
| T |
38346480 |
atagtagtgtaaaatgtataccaacaaactgat |
38346448 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University