View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14807_low_1 (Length: 433)
Name: NF14807_low_1
Description: NF14807
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14807_low_1 |
 | |
|
| [»] scaffold0001 (3 HSPs) |
| | |
|
Alignment Details
Target: scaffold0001 (Bit Score: 86; Significance: 6e-41; HSPs: 3)
Name: scaffold0001
Description:
Target: scaffold0001; HSP #1
Raw Score: 86; E-Value: 6e-41
Query Start/End: Original strand, 288 - 417
Target Start/End: Original strand, 506910 - 507039
Alignment:
| Q |
288 |
gctgcattcatattgaaccggtctggtttgtcgaaaccgttggtttgccagttttgttcaagttgcaccagctcacgccggtttgaaagtgtagcgattc |
387 |
Q |
| |
|
||||| ||| |||||||| ||||||||||||| |||||| || |||||| |||||| ||||||||||||||||||||||||||||||| |||| ||||| |
|
|
| T |
506910 |
gctgctttcgtattgaactggtctggtttgtcaaaaccgctgatttgccggttttgaccaagttgcaccagctcacgccggtttgaaagcgtagtgattc |
507009 |
T |
|
| Q |
388 |
attagacaattcgaaccggtcactccacag |
417 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
507010 |
attagacaattcgaaccggtcactccacag |
507039 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001; HSP #2
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 18 - 83
Target Start/End: Original strand, 506690 - 506755
Alignment:
| Q |
18 |
atatgtcttttttataccaacactaaaatcaacatttcaaaattatttgtcctcattatcataatt |
83 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
506690 |
atatgtcttttttataccaacactaaaatcaacatttcaaaattatttgtcctcattatcaaaatt |
506755 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001; HSP #3
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 130 - 189
Target Start/End: Original strand, 506755 - 506814
Alignment:
| Q |
130 |
tattataatatacatgtatcgaaatttggatcctaaattcatcaattaatcattttaaat |
189 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
506755 |
tattataatatacatggatctaaatttggatcctaaattcatcaattaatcattttaaat |
506814 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University