View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14807_low_4 (Length: 244)
Name: NF14807_low_4
Description: NF14807
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14807_low_4 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 51 - 225
Target Start/End: Original strand, 34381383 - 34381555
Alignment:
| Q |
51 |
tttacgggcatacttacactagtagatttgatatacttgagtagtaattaacagccacaataagaaaaacaacccgacactagagctactaatatgatct |
150 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34381383 |
tttacgggcatacttacgctagtagatttgatatacttgagtagtaattaacagccacaataagaaaaacaacccgacactagagctactaatatgatct |
34381482 |
T |
|
| Q |
151 |
ttcaaccagcaacacttgtaaggttgacatgagttctannnnnnnattttatttgatgttgattttggttagatt |
225 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
34381483 |
ttcaaccagcaacacttgtaaggttaacatgagttctatttttt--ttttatttgatgttgattttggttagatt |
34381555 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University