View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14808_low_14 (Length: 305)
Name: NF14808_low_14
Description: NF14808
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14808_low_14 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 20 - 277
Target Start/End: Complemental strand, 34500941 - 34500685
Alignment:
| Q |
20 |
gcatggatattttaacgatcaggttaatttgtggtcaaaaaatggggaaccaattacatttttaatgttatattatttaatggtagtgtgtagggtgtaa |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||| ||||||||||||||||| |
|
|
| T |
34500941 |
gcatggatattttaacgatcaggttaatttgtggtcaaaaaatggggaaccaattacatttttaatgttatatttt---atgctagtgtgtagggtgtaa |
34500845 |
T |
 |
| Q |
120 |
cattttatatatttgcacatgataatttattagcagcttcttttaaaaacttaaaatttagacgccttctgatggc--tagctgtttgttttagattgtt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
34500844 |
cattttatatatttgcacatgataatttattagcagtttcttttaaaaacttaaaatttagacgccttctgatggctatagctgtttgttttagattgtt |
34500745 |
T |
 |
| Q |
218 |
tcaaccacaaatatctaagttttatagtcctaagcaatttttgtttataaaaaataaaca |
277 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34500744 |
tcaaccacaaatatctaaggtttatagtcctaagcaatttttgtttataaaaaataaaca |
34500685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University