View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14808_low_15 (Length: 304)
Name: NF14808_low_15
Description: NF14808
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14808_low_15 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 277; Significance: 1e-155; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 4 - 288
Target Start/End: Original strand, 33306279 - 33306563
Alignment:
| Q |
4 |
tcaactaattacagctacaacgttatcaccaacaaagacgaacgcttactcgaacaaatcgagaacgataacaacaacaccaacgttgttgcaaactcaa |
103 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33306279 |
tcaactaattacagttacaacgttatcaccaacaaagacgaacgcttactcgaacaaatcgagaacgataacaacaacaccaacgttgttgcaaactcaa |
33306378 |
T |
 |
| Q |
104 |
caacaattgcagccattgtaacatccctaggcggtcccccagccgccgtcggaatcgttcgcctttcaggtccgcacgcggtgtctatcgcgggtcgagt |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33306379 |
caacaattgcagccattgtaacatccctaggcggtcccccagccgccgtcggaatcgttcgcctttcaggtccgcacgcggtgtctatcgcgggtcgagt |
33306478 |
T |
 |
| Q |
204 |
tttccgacccgcaagaaacacgtggcggcctactagtcatgttgttgaatacggtgtcgttttggattccgatggaaatgttgtt |
288 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33306479 |
tttccgacccgcgagaaacacgtggcggcctactagtcatgttgttgaatacggtgtcgttttggattccgatggaaatgttgtt |
33306563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University