View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14808_low_18 (Length: 273)
Name: NF14808_low_18
Description: NF14808
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14808_low_18 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 5 - 256
Target Start/End: Complemental strand, 8457115 - 8456864
Alignment:
| Q |
5 |
acagaggaaagacaataaattattgcactttaagaccctagaatcgtatgcctaatacttcaaaggcagttgattttaccttcaggcgagaaggaatgag |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
8457115 |
acagaggaaagacaataaattattgcacttcaagaccctagaatcgtatgcctaatacttcaaaggcagttgatttaaccttcaggcgagaaggaatgag |
8457016 |
T |
|
| Q |
105 |
ttggcggtggcaaccatgctgaagtgattccagctttagctatgtccggaactttgctttctaaatttgcccaccaatcgtatttgtgagactcccagtt |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8457015 |
ttggcggtggcaaccatgctgaagtgattccagctttagctatgtccggaactttgctttctaaatttgcccaccaatcgtatttgtgagactcccagtt |
8456916 |
T |
|
| Q |
205 |
aaatgcctacaaagcaattttcttcaattgtgagatgtattgtatgcgaagt |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
8456915 |
aaatgcctacaaagcaattttcttcaattgtgagatttattgtatgcgaagt |
8456864 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University