View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14808_low_19 (Length: 241)
Name: NF14808_low_19
Description: NF14808
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14808_low_19 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 16 - 241
Target Start/End: Complemental strand, 55479329 - 55479102
Alignment:
| Q |
16 |
attttgatgtatcctattaactcttctccatcttaagccaagttgtagagtgtacatttcatattaaatgattgatttgttttgttttactgagtaattt |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55479329 |
attttgatgtatcctattaactcttctccatcttaagccaagttgtagagtctacatttcatattaaatgattgatttgttttgttttactgagtaattt |
55479230 |
T |
 |
| Q |
116 |
tcattgcatgtataaa--ctacatatgtaacttgaattcaaaattaccactgatatctgaataaaatgatcttcatgtaatcatggtagaaatatcgaga |
213 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55479229 |
tcattgcatgtataaattctacatatgtaacttgaattcaaaattaccactgatatctgaataaaatgatcttcatgtaatcatggtagaaatatcgaga |
55479130 |
T |
 |
| Q |
214 |
tcaagaatattctcataaaggtaagtta |
241 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
55479129 |
tcaagaatattctcataaaggtaagtta |
55479102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University