View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14808_low_23 (Length: 228)
Name: NF14808_low_23
Description: NF14808
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14808_low_23 |
 | |
|
| [»] scaffold0007 (1 HSPs) |
| | |
|
Alignment Details
Target: chr3 (Bit Score: 77; Significance: 7e-36; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 19 - 143
Target Start/End: Complemental strand, 5565293 - 5565170
Alignment:
| Q |
19 |
aattccgatgcgatggtcaacgatggtggtgcaactccgacgtggtggaaagcaagtgggtttttgtagaggatgaagagatgaagacgatgatgctttt |
118 |
Q |
| |
|
|||||||| || |||||||||| ||||||||||||||| ||||||||||| |||||||||||| |||||||| |||||||| ||||| ||||||||||| |
|
|
| T |
5565293 |
aattccgacgcagtggtcaacgacggtggtgcaactccggcgtggtggaaaacaagtgggtttt-gtagaggacgaagagattaagactatgatgctttt |
5565195 |
T |
|
| Q |
119 |
actttagtgggagaaggctaaaaaa |
143 |
Q |
| |
|
||||||||||||||||||| ||||| |
|
|
| T |
5565194 |
actttagtgggagaaggctgaaaaa |
5565170 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 45 - 125
Target Start/End: Original strand, 14175288 - 14175364
Alignment:
| Q |
45 |
tggtgcaactccgacgtggtggaaagcaagtgggtttttgtagaggatgaagagatgaagacgatgatgcttttactttag |
125 |
Q |
| |
|
||||||||||||| ||||||||||||||| |||| |||||||||||| ||||| |||||||| |||||||||||||||| |
|
|
| T |
14175288 |
tggtgcaactccggcgtggtggaaagcaaatggg-ttttgtagaggacgaagaaatgaagac---gatgcttttactttag |
14175364 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 81 - 118
Target Start/End: Complemental strand, 13539524 - 13539487
Alignment:
| Q |
81 |
tttgtagaggatgaagagatgaagacgatgatgctttt |
118 |
Q |
| |
|
|||| ||||||||||||||||||||| ||||||||||| |
|
|
| T |
13539524 |
tttgcagaggatgaagagatgaagacaatgatgctttt |
13539487 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 74; Significance: 4e-34; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 84 - 181
Target Start/End: Original strand, 43618600 - 43618697
Alignment:
| Q |
84 |
gtagaggatgaagagatgaagacgatgatgcttttactttagtgggagaaggctaaaaaattaacgaaatgagggaataagaagaagagtttttgtgt |
181 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||| ||||||||||| |||||||||| |
|
|
| T |
43618600 |
gtagaagatgaagagatgaagacgatgatgcttttactttagtgggagaaggctaaaaaatgaagcaaatgagggcataagaagaagggtttttgtgt |
43618697 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 49; Significance: 4e-19; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 81 - 133
Target Start/End: Complemental strand, 7854298 - 7854246
Alignment:
| Q |
81 |
tttgtagaggatgaagagatgaagacgatgatgcttttactttagtgggagaa |
133 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7854298 |
tttgcagaggatgaagagatgaagacgatgatgcttttactttagtgggagaa |
7854246 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 80 - 141
Target Start/End: Original strand, 31952902 - 31952963
Alignment:
| Q |
80 |
ttttgtagaggatgaagagatgaagacgatgatgcttttactttagtgggagaaggctaaaa |
141 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| |||| ||||||||||| |||| |||| |
|
|
| T |
31952902 |
ttttgtagaggatgaagagatgaagatgatgatggctttattttagtgggaggaggccaaaa |
31952963 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: scaffold0007
Description:
Target: scaffold0007; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 32 - 110
Target Start/End: Complemental strand, 257735 - 257658
Alignment:
| Q |
32 |
tggtcaacgatggtggtgcaactccgacgtggtggaaagcaagtgggtttttgtagaggatgaagagatgaagacgatg |
110 |
Q |
| |
|
|||||||||| ||||| ||||||| ||||| ||||||||| |||||||| |||||||| ||||| |||||||||||| |
|
|
| T |
257735 |
tggtcaacgacagtggtttaactccggcgtggaggaaagcaaatgggtttt-gtagaggacgaagaaatgaagacgatg |
257658 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University