View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14809_high_10 (Length: 288)
Name: NF14809_high_10
Description: NF14809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14809_high_10 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 161; Significance: 7e-86; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 161; E-Value: 7e-86
Query Start/End: Original strand, 18 - 178
Target Start/End: Complemental strand, 38299374 - 38299214
Alignment:
| Q |
18 |
gaaattagggttttggagagagagactaaggaaatgaagaagaggaagagacagtgagaaatgagttcttcccgggcttactatttatattccccccaaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38299374 |
gaaattagggttttggagagagagactaaggaaatgaagaagaggaagagacagtgagaaatgagttcttcccgggcttactatttatattccccccaaa |
38299275 |
T |
|
| Q |
118 |
ttgatgtacgatccgaaaccctaaacgggtaccctcgggtcagggttaaacgggttagccg |
178 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38299274 |
ttgatgtacgatccgaaaccctaaacgggtaccctcgggtcagggttaaacgggttagccg |
38299214 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 97; Significance: 1e-47; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 18 - 178
Target Start/End: Original strand, 4583185 - 4583340
Alignment:
| Q |
18 |
gaaattagggttttggagagagagactaaggaaatgaagaagaggaagagacagtgagaaatgagttcttcccgggcttactatttatattccccccaaa |
117 |
Q |
| |
|
||||||||||||||||||||||| || ||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||| |||||||| |
|
|
| T |
4583185 |
gaaattagggttttggagagaga-ac-aaggaaatgaagaagaggaagagactgtgagaaatgagttcttcccaggcttactatttatatt-cccccaaa |
4583281 |
T |
|
| Q |
118 |
ttgatgtacgatccgaaaccctaaacgggtaccctcgggtcagggttaaacgggttagccg |
178 |
Q |
| |
|
|||||||| |||| |||||||||||| || ||||||||||| |||||||||||||||||| |
|
|
| T |
4583282 |
ttgatgtatgatctgaaaccctaaac-cgtgccctcgggtca-ggttaaacgggttagccg |
4583340 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University