View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14809_high_15 (Length: 241)
Name: NF14809_high_15
Description: NF14809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14809_high_15 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 19 - 236
Target Start/End: Original strand, 9515604 - 9515821
Alignment:
| Q |
19 |
aaaattgatgtctttagtgatagtggatttgatttttgtgcacaaaataagctactttggagagtgcatgaattagtcaaggttgttgagaaggccattt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||| |
|
|
| T |
9515604 |
aaaattgatgtctttagtgatagtggatttgatttttgtgcacaaaataagctactttggagagtgcatgaattggtcaaggttgtggagaaggccattt |
9515703 |
T |
 |
| Q |
119 |
gtggtatcttgattaagatttgagtatgcatttggttgttgatcatgttatttatatgttaaatattatattctttttcctatgttagaagtaaaacaaa |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
9515704 |
gtggtatcttgattaagatttgagtatgcatttggttgttgatcatgttatttatatgttaaatattatattctttttcctacgttagaagtaaaacaaa |
9515803 |
T |
 |
| Q |
219 |
tagtacccctttgctact |
236 |
Q |
| |
|
|||||||| |||| |||| |
|
|
| T |
9515804 |
tagtacccttttgttact |
9515821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University