View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14809_low_12 (Length: 281)
Name: NF14809_low_12
Description: NF14809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14809_low_12 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 131; Significance: 5e-68; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 131; E-Value: 5e-68
Query Start/End: Original strand, 21 - 177
Target Start/End: Original strand, 14396256 - 14396411
Alignment:
| Q |
21 |
aaagtgatataagaatccaatttgaaaggaaacttgaattcttaacataaaatccaaacacatccaatagttgttgaacatgattaagatggagcttcag |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14396256 |
aaagtgatataagaatccaatttgaaaggaaacttgaattcttaacataaaatccaaacacatccaatagttgttgaacatgattaagatggagcttcag |
14396355 |
T |
 |
| Q |
121 |
actaacagatagatgtcttgccacaatgnnnnnnntggaatttggagagtaaatcag |
177 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
14396356 |
actaacagatagatgtcttgccacaatg-aaaaaatggaatttggagagtaaatcag |
14396411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University