View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1480_high_29 (Length: 250)
Name: NF1480_high_29
Description: NF1480
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1480_high_29 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 8 - 235
Target Start/End: Complemental strand, 8552546 - 8552318
Alignment:
| Q |
8 |
tgagatgaataaatgagtgactagagtattaatttgatttattgatggttatagcacgtgagtgagttataaataagtactgtagacagagatttaggtg |
107 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8552546 |
tgagatgaataaatgagtcactagagtattaatttgatttattaatggttatagcacgtgagtgagttataaataagtactgtagacagagatttaggtg |
8552447 |
T |
 |
| Q |
108 |
gggaccaatgaagccatttttgtcagtggtgtggtcttaaggaactgacaacttgtacggcaagtttggttttc-nnnnnnnctcattgtctgattcata |
206 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
8552446 |
gggaccaatgaagccatctttgtcagtggtgtggtcttaaggaactgacaacttgtacggcaagtttggttttcttttttttctcattgtctgattcata |
8552347 |
T |
 |
| Q |
207 |
ttattaatatcttcttatgctatagtata |
235 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
8552346 |
ttattaatatcttcttatgctatagtata |
8552318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University