View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1480_low_10 (Length: 399)
Name: NF1480_low_10
Description: NF1480
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1480_low_10 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 128 - 384
Target Start/End: Original strand, 39714992 - 39715248
Alignment:
| Q |
128 |
attaaaaagtatatcgagacaacatcatagtcttttctttttgttcttgccatgaagcataaagaagttcaggtgactcttgcgaaaatatgtagtgaaa |
227 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39714992 |
attacaaagtatatcgagacaacatcatagtcttttctttttgttcttgccatgaagcataaagaagttcaggtgactcttgcgaaaatatgtagtgaaa |
39715091 |
T |
 |
| Q |
228 |
aagtagagatgaatgcagtgtcttttgcaaaatctcttttgtaaaaaagttaatagatcactgctcaatccaatgaagagaattttgaatcaattatgaa |
327 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39715092 |
aagtagagatgtatgcagtgtcttttgcaaaatctcttttgtaaaaaagttaatagatcactgctcaatccaatgaagagaattttgaatcaattatgaa |
39715191 |
T |
 |
| Q |
328 |
attttcttttttaaatgtataatgagattgagtattttaattgtgaaattattaact |
384 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39715192 |
attttcttttctaaatgtataatgagattgagtattttaattgtgaaattattaact |
39715248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University