View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1480_low_14 (Length: 378)
Name: NF1480_low_14
Description: NF1480
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1480_low_14 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 292; Significance: 1e-164; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 292; E-Value: 1e-164
Query Start/End: Original strand, 19 - 368
Target Start/End: Complemental strand, 32061173 - 32060824
Alignment:
| Q |
19 |
tggacccctaggattagttggtttttgggattttacggagttttnnnnnnnnnnnnnntcggtctaataaaatttgatcttgctgttctcagtctaatgc |
118 |
Q |
| |
|
||||||||||||||||||||||| |||| ||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32061173 |
tggacccctaggattagttggttattggaattatacggagttttaaaaaaaaaaaaaatcggtctaataaaatttgatcttgctgttctcagtctaatgc |
32061074 |
T |
|
| Q |
119 |
cactttacctgcttttgttctaaggtttcttggttttgttagaaagtcagtttcagctctttaaagtccatgttgcactttagagggtaaaaatatattt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32061073 |
cactttacctgcttttgttctaaggtttcttggttttgttagaaagtcagtttcagctctttaaagtccatgttgcactttagagggtaaaaatatattt |
32060974 |
T |
|
| Q |
219 |
tttgctaattcaaatcgaacatatgtttaggttttgctgttaagcagtctgactgtctagaattttttatcagtaaatgatttattcattgactatcccc |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32060973 |
tttgctaattcaaatcgaacatatgtttaggttttgctgttaagcagtctgactgtctagaattttttatcagtaaatgatttattcattgactatcccc |
32060874 |
T |
|
| Q |
319 |
tgcttacggattcttaatttatcactcttgtgtgtttagacttgcctatg |
368 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
32060873 |
tgcttacggattcttaatttatcactcttgtgtgtttaggcttgcctatg |
32060824 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University