View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1480_low_16 (Length: 359)
Name: NF1480_low_16
Description: NF1480
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1480_low_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 334; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 334; E-Value: 0
Query Start/End: Original strand, 1 - 342
Target Start/End: Original strand, 35034681 - 35035022
Alignment:
| Q |
1 |
cagctggagtgcgtagaaatgtcagcatgccgccaccaccatcaccaccatctgcattgcctatggttcaccctctccctccttttcaccaatatggcta |
100 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35034681 |
cagctggagtgcgtagaaatgccagcatgccgccaccaccatcaccaccatctgcattgcctatggttcaccctctccctccttttcaccaatatggcta |
35034780 |
T |
 |
| Q |
101 |
tataccttatggtatgaattacggttggcctaataccatgatgtggcctttattaaacatgtcgggcaataccatgatgcaacctttcttgaacatgacg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35034781 |
tataccttatggtatgaattacggttggcctaataccatgatgtggcctttattaaacatgtcgggcaataccatgatgcaacctttcttgaacatgacg |
35034880 |
T |
 |
| Q |
201 |
ggtaacaccatgatgcaaccttacagacccataagcgaacaaaattttctagaacgtcgtgtttcaactccaactcctattggtacaaatcaagttggac |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35034881 |
ggtaacaccatgatgcaaccttacagacccataagtgaacaaaattttctagaacgtcgtgtttcaactccaactcctattggtacaaatcaagttggac |
35034980 |
T |
 |
| Q |
301 |
ctaatatcaatagggcagttccgcttcctgtatttccgatat |
342 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35034981 |
ctaatatcaatagggcagttccgcttcctgtatttccgatat |
35035022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University