View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1480_low_26 (Length: 258)
Name: NF1480_low_26
Description: NF1480
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1480_low_26 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 17 - 258
Target Start/End: Original strand, 44464834 - 44465075
Alignment:
| Q |
17 |
agttttcgggtcaaactcaggctagtcagctgtttctcatagttcccgtctcatattaagccttcgattttgtattgtttttccaaaatatataatctaa |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
44464834 |
agttttcgggtcaaactcaggctagtcagctgtttctcatagttcccgtctcatattaaaccttcgattttgtattgtttttccgaaatatataatctaa |
44464933 |
T |
 |
| Q |
117 |
ttgaatttataactgcaggttatattatgtaatgactgtgaaaagaaaggagcagctcccttccactggctttaccacaaatgctcttgttgtggttcct |
216 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44464934 |
ttgaatttataactgcaggttattttatgtaatgactgtgaaaagaaaggagcagctcccttccactggctttaccacaaatgctcttgttgtggttcct |
44465033 |
T |
 |
| Q |
217 |
ataacactagagttatatgattcttccagtgtgagcatagat |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44465034 |
ataacactagagttatatgattcttccagtgtgagcatagat |
44465075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University