View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1480_low_28 (Length: 253)
Name: NF1480_low_28
Description: NF1480
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1480_low_28 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 7 - 253
Target Start/End: Original strand, 3570237 - 3570462
Alignment:
| Q |
7 |
gaagcataggcatccatttgaatggttcacattctctagctgtggtaacagccagaattacaatgagtcagcataaagttctaactaaaaacagaaagca |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
3570237 |
gaagcataggcatccatttgaatggttcacattctctagctgtggtaacagccagaatt---------------------ctaactaaaaacagaaagca |
3570315 |
T |
 |
| Q |
107 |
tgctataaatggtataacagttgggggtccataaataaaaccggtctgcactaaaattttcagactaaatataatgatctttattttgaacatcaatgga |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3570316 |
tgctataaatggtataacagttgggggtccataaataaaaccggtctgcactaaaattttcagactaaatataatgatctttattttgaacatcaatgga |
3570415 |
T |
 |
| Q |
207 |
aaatttaattatacgtaaactattcagttttatgtctctgttggagt |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3570416 |
aaatttaattatacgtaaactattcagttttatgtctctgttggagt |
3570462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University