View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1480_low_34 (Length: 240)
Name: NF1480_low_34
Description: NF1480
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1480_low_34 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 18 - 229
Target Start/End: Original strand, 2096922 - 2097137
Alignment:
| Q |
18 |
gagggaattcaggaattgaaatatttagaagtttgcagaaatatagttagataattattcatgaggagtgaggtatagagcaagccagaagggttccacc |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
2096922 |
gagggaattcaggaattgaaatatttagaagttagcagaaatatagttagataattattcatgaggagtgaggtatagagcaagccagaaggattccacc |
2097021 |
T |
 |
| Q |
118 |
ctgtaaagtcggattatgtt----catgcatgcaagccatttgtatatagatacgttattagttaaacgttgtctgttaagcataataaatgcttcatac |
213 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
2097022 |
ctgtaaagtcggattatgttcatgcatgcatgcaagccatttgtatatagatacgttattagttaaacgctgtctgttaagcataataaatgcttcatac |
2097121 |
T |
 |
| Q |
214 |
tactattagttttcat |
229 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
2097122 |
tactattagttttcat |
2097137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University