View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1480_low_37 (Length: 224)
Name: NF1480_low_37
Description: NF1480
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1480_low_37 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 21 - 210
Target Start/End: Complemental strand, 16127733 - 16127537
Alignment:
| Q |
21 |
tatgttatatgaaagtccacttctaaaaacatgtgtgatatttaagaaatgagggtagagaaaattgctccttgtg-------gaatcaaagcacaacca |
113 |
Q |
| |
|
|||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
16127733 |
tatgttatatgaaagttcagttctaaaaacatgtgtgatatttaagaaatgagggtagagaaaattgctccttgtgattttgggaatcaaagcacaacca |
16127634 |
T |
|
| Q |
114 |
acatgctcatatcttccccnnnnnnntgttcctttagcacaaccaacaattttttattatatatagaaagaaaaacaaaacaaataaaattgcttat |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16127633 |
acatgctcatatcttccccaaaaaaatgttcctttagcacaaccaacaattttttattttatatagaaagaaaaacaaaacaaataaaattgcttat |
16127537 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University