View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14810_high_6 (Length: 222)
Name: NF14810_high_6
Description: NF14810
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14810_high_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 12 - 205
Target Start/End: Complemental strand, 22792653 - 22792460
Alignment:
| Q |
12 |
agatgaagatggattgaagacttcaagtgagcctcgatggtctcttgtaaatggttccatcactttcactttctgtttcattgttgttcatgtacatata |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22792653 |
agatgaagatggattgaagacttcaagtgagcctcgatggtctcttgtaaatggttccatcactttcactttctgtttcattgttgttcatgtacatata |
22792554 |
T |
|
| Q |
112 |
aattattaacaactatagtaattcatgatgcaaattgtactcactaatagtaataaataagtaactgaaattttgcatttctaattgtttaact |
205 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22792553 |
aataattaacaactatagtaattcatgatgcaaattgtactcactaatagtgataaataagtaactgaaattttgcatttctaattgtttaact |
22792460 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University