View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14810_low_3 (Length: 369)
Name: NF14810_low_3
Description: NF14810
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14810_low_3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 124; Significance: 1e-63; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 124; E-Value: 1e-63
Query Start/End: Original strand, 4 - 231
Target Start/End: Complemental strand, 38667012 - 38666787
Alignment:
| Q |
4 |
ataatactatttcttttacaaatatttgatcnnnnnnnnnaatgacaacgattaatatgttaattgtcatgtagtannnnnnnct-ccttaccataactt |
102 |
Q |
| |
|
|||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| || |||||||||||||| |
|
|
| T |
38667012 |
ataatactctttcttttacaaatatttgatctttttttt-aatgacaacgattaatatgttaattgtcatgtagtatttttttcttccttaccataactt |
38666914 |
T |
 |
| Q |
103 |
aaatattgcacatttaactttatcaacgctttannnnnnnaactcaaatcagatgaactacttaaccccataaactttaaaccatgtttgcttgttagta |
202 |
Q |
| |
|
| ||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
38666913 |
a--tattgtacatttaactttatcaacgctttattttcttaactcaaatcagatgaactacttaaccccataaactttaaacgatgtttgcttgttagta |
38666816 |
T |
 |
| Q |
203 |
attaagcacactttgcaaacaaatgcgtt |
231 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
38666815 |
attaagcacactttgcaaacaaatgcgtt |
38666787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 281 - 351
Target Start/End: Complemental strand, 38666735 - 38666665
Alignment:
| Q |
281 |
acaaatatttcatatcaacatgtttgctagctagtaactaagcacgccttgcattgatatgaactaacgtt |
351 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
38666735 |
acaaatatttcatatcaacatgtttgctagctagtaactaagcacgccttgcattgatatgaacttacgtt |
38666665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University