View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14812_high_12 (Length: 280)
Name: NF14812_high_12
Description: NF14812
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14812_high_12 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 232; Significance: 1e-128; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 25 - 280
Target Start/End: Original strand, 55269442 - 55269697
Alignment:
| Q |
25 |
agaaaactctaggcattgatgcatttgtcatgaggtcattcactgaccgaacactaaggttttgtacgagagtttggaggaaaaggaaggtgaggaatct |
124 |
Q |
| |
|
||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
55269442 |
agaaacctctaggcattgatgcatttgtcatgtggtcattcactgaccgaacactaaggttttgtacgagagtttggaggaaagggaaggtgaggaatct |
55269541 |
T |
 |
| Q |
125 |
gaggataacaggagaaagaaagattatgagaatttggaaataaatatacaattttacaaaaatgaggatggaagtaaagaggctttccacaaatacaatt |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55269542 |
gaggataacaggagaaagaaagattatgagaatttgaaaataaatatacaattttacaaaaatgaggatggaagtaaagaggctttccacaaatacaatt |
55269641 |
T |
 |
| Q |
225 |
aaataaatataaattgcaatcatactcctcaatagaagcaaagggaaaaatgaact |
280 |
Q |
| |
|
||||| ||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
55269642 |
aaatagatataaattgcaatcatactcttcaatagaagcaaagggaaaaatgaact |
55269697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 25 - 107
Target Start/End: Original strand, 55262739 - 55262825
Alignment:
| Q |
25 |
agaaaactctaggcattgatgcatttgtcatgaggtcattcac----tgaccgaacactaaggttttgtacgagagtttggaggaaa |
107 |
Q |
| |
|
||||| || ||||||||||||||||||| ||| |||| ||||| |||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
55262739 |
agaaacctataggcattgatgcatttgtaatgtggtcgttcaccgaacgaccgaccactaaggttttgtacgggagtttggaggaaa |
55262825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University