View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14812_low_16 (Length: 279)
Name: NF14812_low_16
Description: NF14812
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14812_low_16 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 15 - 279
Target Start/End: Original strand, 6223496 - 6223760
Alignment:
| Q |
15 |
tcatcacacggaatcctgcatttggtacattagtcaccattcgatcaacattagatggtctaaaaacatacannnnnnnnagttttaatattaaaaaacc |
114 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
6223496 |
tcatcacacggaatcctgcatttggaacattagtcaccattcgatcaacattagatggtctaaaaacatacattttttttagttttaatattaaaaaacc |
6223595 |
T |
 |
| Q |
115 |
gagcttgaattccgatcttttgatcatgacttagcggtaactgatgtcccgaactcgtgaatgcgaaaaaataccgattatattcatcggtggatttatc |
214 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
6223596 |
gagcttgaattccgatcttttgatcataacttagcggtaactgatgtcccgaactcgtgaatgcgaaaaaataccgactatattcatcggtggatttatc |
6223695 |
T |
 |
| Q |
215 |
atttattgagcaaacaggattgtgctttggcatctccataactatgcaaagtggttaaatggtaa |
279 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
6223696 |
atttattgagcaaacaggattgtgctttggcatctgcataactatgcaaagtggttaaatggtaa |
6223760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University