View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14812_low_21 (Length: 243)
Name: NF14812_low_21
Description: NF14812
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14812_low_21 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 14 - 227
Target Start/End: Complemental strand, 4566322 - 4566112
Alignment:
| Q |
14 |
agatgaataactacattctttcttaatgtgtggaatcggtggtatttaacaatcagtctcaattgtagcggtgaaaagtgatgcaatattaatgtggtac |
113 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
4566322 |
agatcaataactacattctttcttaatgtgtggaatcggtggtatttaacaatcagtctcaattgtagcggtgaaaagtgatgcaatactaatgtggtac |
4566223 |
T |
 |
| Q |
114 |
tgctatatatctgcaaagtggcagcaagagaccaaaacattgcagcaaaaactatgcacatagaattccaaaaggattgatcttaatcttaaattcaatt |
213 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4566222 |
t---atatatctgcaaagtggcagcaagagaccaaaacattgcagcaaaaactatgcacatagaattccaaaaggattgatcttaatcttaaattcaatt |
4566126 |
T |
 |
| Q |
214 |
tttggatatgttta |
227 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
4566125 |
tttggatatgttta |
4566112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University