View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14812_low_21 (Length: 243)

Name: NF14812_low_21
Description: NF14812
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14812_low_21
NF14812_low_21
[»] chr7 (1 HSPs)
chr7 (14-227)||(4566112-4566322)


Alignment Details
Target: chr7 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 14 - 227
Target Start/End: Complemental strand, 4566322 - 4566112
Alignment:
14 agatgaataactacattctttcttaatgtgtggaatcggtggtatttaacaatcagtctcaattgtagcggtgaaaagtgatgcaatattaatgtggtac 113  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
4566322 agatcaataactacattctttcttaatgtgtggaatcggtggtatttaacaatcagtctcaattgtagcggtgaaaagtgatgcaatactaatgtggtac 4566223  T
114 tgctatatatctgcaaagtggcagcaagagaccaaaacattgcagcaaaaactatgcacatagaattccaaaaggattgatcttaatcttaaattcaatt 213  Q
    |   ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4566222 t---atatatctgcaaagtggcagcaagagaccaaaacattgcagcaaaaactatgcacatagaattccaaaaggattgatcttaatcttaaattcaatt 4566126  T
214 tttggatatgttta 227  Q
    ||||||||||||||    
4566125 tttggatatgttta 4566112  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University