View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14812_low_4 (Length: 463)
Name: NF14812_low_4
Description: NF14812
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14812_low_4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 239; Significance: 1e-132; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 207 - 449
Target Start/End: Original strand, 32582050 - 32582292
Alignment:
| Q |
207 |
gtttaattttcaatgcagttctttgacatttgcaagtgttcgtagattgctcgagaaagatttagggtttgacgagttttctttggattctcacaaaaaa |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32582050 |
gtttaattttcaatgcagttctttgacatttgcaagtgttcgtagattgctcgagaaagatttagggtttgacgagttttctttggattctcacaaaaaa |
32582149 |
T |
|
| Q |
307 |
tttatcaaacaatctttagacaaggtccttccctacactcttcttttttcaaaaaccctaattccaactcgtcaattgtgctttcaatcattaacttatt |
406 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32582150 |
tttatcaaacaatctttagacaaggtccttccctacactcttcttttttcaaaaaccctaattccaactcgtcaattgtgctttcaatcattaacttatt |
32582249 |
T |
|
| Q |
407 |
ttaagcgcttatcatgataagctcatatttataagctattttt |
449 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
32582250 |
ttaagcgcttatcatgacaagctcatatttataagctattttt |
32582292 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 118; E-Value: 5e-60
Query Start/End: Original strand, 17 - 138
Target Start/End: Original strand, 32581859 - 32581980
Alignment:
| Q |
17 |
cagagagaacatggcagaagatggaacgaagaagatgaatgacgatgtcgacgtggttcagtctcagattgaaactgcgatgcgctctcgcgtttctcac |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
32581859 |
cagagagaacatggcagaagatggaacgaagaagatgaatgacgatgtcgacgtggttcagtctcagattgaaaatgcgatgcgctctcgcgtttctcac |
32581958 |
T |
|
| Q |
117 |
ttcaagcaacaagccgagtttg |
138 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
32581959 |
ttcaagcaacaagccgagtttg |
32581980 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 33; Significance: 0.000000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 408 - 448
Target Start/End: Original strand, 7612375 - 7612415
Alignment:
| Q |
408 |
taagcgcttatcatgataagctcatatttataagctatttt |
448 |
Q |
| |
|
||||| ||||||||||||||||||||| ||||||||||||| |
|
|
| T |
7612375 |
taagcacttatcatgataagctcatatgtataagctatttt |
7612415 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University