View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14813_high_10 (Length: 482)
Name: NF14813_high_10
Description: NF14813
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14813_high_10 |
 | |
|
| [»] scaffold0392 (1 HSPs) |
| | |
|
Alignment Details
Target: chr4 (Bit Score: 286; Significance: 1e-160; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 286; E-Value: 1e-160
Query Start/End: Original strand, 48 - 370
Target Start/End: Complemental strand, 49457348 - 49457026
Alignment:
| Q |
48 |
gcttcgtagtgcattgaattggtgctgcatttgctcaccgaattgaacttgatttgaggatgctataaagtttagttcttggtgggaattttgagtgtat |
147 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49457348 |
gcttcgtagtgtattgaattggtgctgcatttgctcagcgaattgaacttgattagaggatgctataaagtttagttcttggtgggaattttgagtgtat |
49457249 |
T |
|
| Q |
148 |
cacactgaattttggaatagaatgttcagtccaagcatggattctgcaagggatgtgggtggagttgttgccgcagggacggtgctgattccagtgcggt |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49457248 |
cacactgaattttggaatagaatgttcagtccaagcatggattctgcaagggatgtgggtggtgttgttgccgcagggacggtgctgattccagtgcggt |
49457149 |
T |
|
| Q |
248 |
ttgtgtggccatatgggggaagaactgtttatctcagtggttctttcacaaggtatannnnnnnatcaataaatcattacacttcaattctaaaagtttt |
347 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
49457148 |
ttgtgtggccatatgggggaagaactgtttatctcagtggttctttcacaaggtatatatttttatcaataaatcattacacttcaattctaaaagtttt |
49457049 |
T |
|
| Q |
348 |
gattttttggttcaaaaactcta |
370 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
49457048 |
gattttttggttcaaaaactcta |
49457026 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 437 - 473
Target Start/End: Complemental strand, 49456959 - 49456923
Alignment:
| Q |
437 |
aataagaaaaatttaaattttgtctcaaaggtggtct |
473 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49456959 |
aataagaaaaatttaaattttgtctcaaaggtggtct |
49456923 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0392 (Bit Score: 35; Significance: 0.0000000002; HSPs: 1)
Name: scaffold0392
Description:
Target: scaffold0392; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 223 - 297
Target Start/End: Original strand, 1907 - 1981
Alignment:
| Q |
223 |
gggacggtgctgattccagtgcggtttgtgtggccatatgggggaagaactgtttatctcagtggttctttcaca |
297 |
Q |
| |
|
||||| ||||||||||| |||||||||| ||||| ||||| ||||| | ||||| |||||| |||||||||||| |
|
|
| T |
1907 |
gggactgtgctgattcccatgcggtttgtttggccttatggtggaagtagtgtttttctcagcggttctttcaca |
1981 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University