View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14813_low_21 (Length: 270)
Name: NF14813_low_21
Description: NF14813
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14813_low_21 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 184; Significance: 1e-99; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 20 - 207
Target Start/End: Original strand, 4657941 - 4658128
Alignment:
| Q |
20 |
agtgacgggttgtgaaagctcttgaaattcgtaaactcgagtgtttctgaacatagcctggaaattttgaccaaaaatctcacatgctttcaaatcgtgg |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4657941 |
agtgacgggttgtgaaagctcttgaaattcgtaaactcgagtgtttctgaacatagcctggaaattttgaccaaaaatctcacatgctttcaaatcgtgg |
4658040 |
T |
|
| Q |
120 |
gagcagaagggtaggggacccatataactgaagatgatatttcttcatcatcaacagaaccctaatcgctagtactttctaaatatga |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
4658041 |
gagcagaagggtaggggacccatataactgaagatgatatttcttcatcatctacagaaccctaatcgctagtactttctaaatatga |
4658128 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 46 - 171
Target Start/End: Complemental strand, 1038461 - 1038339
Alignment:
| Q |
46 |
attcgtaaactcgagtgtttctgaacatagcctggaaattttgaccaaaaatctcacatgctttcaaatcgtgggagcagaagggtaggggacccatata |
145 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
1038461 |
attcgtaaactcgagtgtttctgaacata--ctggaaattttgaccaaaaatctcacatgctttcaaatcgtgggagcagaagggta-gggacccatata |
1038365 |
T |
|
| Q |
146 |
actgaagatgatatttcttcatcatc |
171 |
Q |
| |
|
| |||||||||||||| ||||||||| |
|
|
| T |
1038364 |
agtgaagatgatatttattcatcatc |
1038339 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 46 - 171
Target Start/End: Complemental strand, 1045367 - 1045245
Alignment:
| Q |
46 |
attcgtaaactcgagtgtttctgaacatagcctggaaattttgaccaaaaatctcacatgctttcaaatcgtgggagcagaagggtaggggacccatata |
145 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
1045367 |
attcgtaaactcgagtgtttctgaacata--ctggaaattttgaccaaaaatctcacatgctttcaaatcgtgggagcagaagggta-gggacccatata |
1045271 |
T |
|
| Q |
146 |
actgaagatgatatttcttcatcatc |
171 |
Q |
| |
|
| |||||||||||||| ||||||||| |
|
|
| T |
1045270 |
agtgaagatgatatttattcatcatc |
1045245 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 238 - 270
Target Start/End: Original strand, 55043517 - 55043549
Alignment:
| Q |
238 |
ctagtcttgagggttgatttttctcctttgctt |
270 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
55043517 |
ctagtcttgagggttgatttttctcctttgctt |
55043549 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University