View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14813_low_24 (Length: 253)
Name: NF14813_low_24
Description: NF14813
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14813_low_24 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 1 - 243
Target Start/End: Complemental strand, 13591540 - 13591298
Alignment:
| Q |
1 |
tcttccactgaatcatgatcgtactcttctctgtagaacgagagatctaaaggatctctatgaatctccaaacagtgcttcgatgacttaagcatgtttc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13591540 |
tcttccactgaatcatgatcgtactcttctctgtagaacgagagatctaaaggatctctatgaatctccaaacagtgcttcgatgacttaagcatgtttc |
13591441 |
T |
|
| Q |
101 |
gtagcatggggttcttaaacctaatgaatccgcagtgccgattcagaaggaaatcacggaggttttggggtatggaatctgcatgacctagttggaatat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
13591440 |
gtagcatggggttcttaaacctaatgaatccgcagtgccgattcagaaggaaatcacggaggttttgcggtatggaatctgcatgacctagttggaatat |
13591341 |
T |
|
| Q |
201 |
aaggcaccggttaccggtgcagagttgcaaagtgtctgcccta |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13591340 |
aaggcaccggttaccggtgcagagttgcaaagtgtctgcccta |
13591298 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University