View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14813_low_32 (Length: 228)
Name: NF14813_low_32
Description: NF14813
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14813_low_32 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 71; Significance: 3e-32; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 1 - 101
Target Start/End: Original strand, 10300191 - 10300293
Alignment:
| Q |
1 |
atatttacagcataaactatgattgatt-tctgtcgacaactttgttacactaaa-ttatcaaatttcataatgaatatgttttaaagaaaatatgtgca |
98 |
Q |
| |
|
|||||||||||||| ||||||||||| | |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||| ||||||| |
|
|
| T |
10300191 |
atatttacagcatagactatgattgaatctctgtcgacaactttgttacactaaagttatcaaatttcataatgaatatgttttaaaaaaaaaatgtgca |
10300290 |
T |
 |
| Q |
99 |
tat |
101 |
Q |
| |
|
||| |
|
|
| T |
10300291 |
tat |
10300293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 1 - 101
Target Start/End: Original strand, 10320627 - 10320728
Alignment:
| Q |
1 |
atatttacagcataaactatgattgattt-ctgtcgacaactttgttacactaaa-ttatcaaatttcataatgaatatgttttaaagaaaatatgtgca |
98 |
Q |
| |
|
|||| |||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||| ||||||| |
|
|
| T |
10320627 |
atatatacagcataaactatgattgattttctgtcgacaactttgttacactaaagttatcaaatttcataatgaatatgttttaaacaaaa-atgtgca |
10320725 |
T |
 |
| Q |
99 |
tat |
101 |
Q |
| |
|
||| |
|
|
| T |
10320726 |
tat |
10320728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 33 - 80
Target Start/End: Complemental strand, 35631613 - 35631565
Alignment:
| Q |
33 |
tcgacaactttgttacactaaa-ttatcaaatttcataatgaatatgtt |
80 |
Q |
| |
|
|||| ||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
35631613 |
tcgagaactttgttacactaaagttatcaaatttcataatgaatatgtt |
35631565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University