View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14814_high_7 (Length: 206)
Name: NF14814_high_7
Description: NF14814
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14814_high_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 176; Significance: 5e-95; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 17 - 192
Target Start/End: Complemental strand, 52011568 - 52011393
Alignment:
| Q |
17 |
tattcaggaacgaattgcgaaaagcaagaaaaaaggggttgttaaggaatcctttatttgggttccgaaaagaaacggagaagatttggtgagggaaagg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52011568 |
tattcaggaacgaattgcgaaaagcaagaaaaaaggggttgttaaggaatcctttatttgggttccgaaaagaaacggagaagatttggtgagggaaagg |
52011469 |
T |
|
| Q |
117 |
tttagggttccttcgttgcaagaaatgtctcttaaaattcttgctaaccatgctgatggaatggtttcgcttgatg |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52011468 |
tttagggttccttcgttgcaagaaatgtctcttaaaattcttgctaaccatgctgatggaatggtttcgcttgatg |
52011393 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 17 - 192
Target Start/End: Complemental strand, 52001703 - 52001528
Alignment:
| Q |
17 |
tattcaggaacgaattgcgaaaagcaagaaaaaaggggttgttaaggaatcctttatttgggttccgaaaagaaacggagaagatttggtgagggaaagg |
116 |
Q |
| |
|
|||||| ||||||||| | |||||||| |||| ||| |||| | |||||| ||| ||||||| | ||| || || |||||||| ||||||| ||| |
|
|
| T |
52001703 |
tattcaagaacgaattactaaaagcaacaaaagggggtttgtcgatgaatcccttacttgggtttcaaaactgaatggtgaagattttgtgaggggaaga |
52001604 |
T |
|
| Q |
117 |
tttagggttccttcgttgcaagaaatgtctcttaaaattcttgctaaccatgctgatggaatggtttcgcttgatg |
192 |
Q |
| |
|
|| | |||||||| ||| |||||||||||||||||||||||| || |||| ||||||| | | ||||||||||| |
|
|
| T |
52001603 |
ttatgtgttccttcactgctagaaatgtctcttaaaattcttgccaatcatgttgatggacttgcttcgcttgatg |
52001528 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 117 - 191
Target Start/End: Original strand, 51988030 - 51988104
Alignment:
| Q |
117 |
tttagggttccttcgttgcaagaaatgtctcttaaaattcttgctaaccatgctgatggaatggtttcgcttgat |
191 |
Q |
| |
|
||||| |||||||| ||||||||| ||| ||||| |||||||| ||||||||||||| || | |||||||||| |
|
|
| T |
51988030 |
tttagtgttccttcattgcaagaattgtgccttaacattcttgcgaaccatgctgatgccattgcttcgcttgat |
51988104 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 64; Significance: 4e-28; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 17 - 192
Target Start/End: Complemental strand, 11749377 - 11749202
Alignment:
| Q |
17 |
tattcaggaacgaattgcgaaaagcaagaaaaaaggggttgttaaggaatcctttatttgggttccgaaaagaaacggagaagatttggtgagggaaagg |
116 |
Q |
| |
|
|||||| ||||||||||| |||| |||||||| ||| ||||| | |||||| ||||||||||||||||||| || |||||||||||||||| |||| |
|
|
| T |
11749377 |
tattcaagaacgaattgccaaaaccaagaaaatggggtttgttgatgaatcccttatttgggttccgaaaaggaatggagaagatttggtgaatagaagg |
11749278 |
T |
|
| Q |
117 |
tttagggttccttcgttgcaagaaatgtctcttaaaattcttgctaaccatgctgatggaatggtttcgcttgatg |
192 |
Q |
| |
|
||| | |||||||| ||| ||||| ||||| ||||| |||||||| |||| ||||||| ||||||| ||||||| |
|
|
| T |
11749277 |
ttttgtgttccttcattggaagaattgtcttttaaagcccttgctaatcatgttgatggattggtttcccttgatg |
11749202 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University