View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14814_low_8 (Length: 249)
Name: NF14814_low_8
Description: NF14814
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14814_low_8 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 10 - 172
Target Start/End: Complemental strand, 5758519 - 5758357
Alignment:
| Q |
10 |
tagagaattgaggtatactcgggaagaaagtagattagtgagaaaatattccggtaaagcatgtccgttctctcacgttgaaagtttggtttcgactcat |
109 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5758519 |
tagagcattgaggtatactcgggaagaaagtagattagtgagaaaatattccggtaaagcatgtccgttctctcacgttgaaagtttggtttcgactcat |
5758420 |
T |
|
| Q |
110 |
tgaaagtaagtactcttctactattgaaaactgtgtgaatgtattgcattgatatatgttgtt |
172 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| ||||||||| |||||||||||||||||| |
|
|
| T |
5758419 |
tgaaagtaagtactcttctactattgacaactgtttgaatgtatggcattgatatatgttgtt |
5758357 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000001; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 84 - 116
Target Start/End: Original strand, 10482457 - 10482489
Alignment:
| Q |
84 |
acgttgaaagtttggtttcgactcattgaaagt |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
10482457 |
acgttgaaagtttggtttcgactcattgaaagt |
10482489 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 84 - 116
Target Start/End: Original strand, 10468318 - 10468350
Alignment:
| Q |
84 |
acgttgaaagtttggtttcgactcattgaaagt |
116 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
10468318 |
acgttgaaagtttggttttgactcattgaaagt |
10468350 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 87 - 129
Target Start/End: Original strand, 5979324 - 5979366
Alignment:
| Q |
87 |
ttgaaagtttggtttcgactcattgaaagtaagtactcttcta |
129 |
Q |
| |
|
||||||| ||||||||||||||||| |||||||| |||||||| |
|
|
| T |
5979324 |
ttgaaagcttggtttcgactcattggaagtaagttctcttcta |
5979366 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University