View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14815_low_5 (Length: 311)
Name: NF14815_low_5
Description: NF14815
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14815_low_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 13 - 292
Target Start/End: Original strand, 7723485 - 7723761
Alignment:
| Q |
13 |
caaaggcaacacgtgcaagtaccaataataacaacaatgattctcttcttgctcgtagatgtgcaaactgtgacaccacctccacaccgctttggaggaa |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7723485 |
caaaggcaacacgtgcaagtaccaataataacaacaatgattctcttcttgctcgtagatgtgcaaactgtgacaccacctccacaccgctttggaggaa |
7723584 |
T |
 |
| Q |
113 |
cggccctcgaggcccaaaggtnnnnnnnntactctaaatatatacattccaaatatataactttatttcaatcttttgatagtttcaatttgaatgggaa |
212 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| | || | ||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
7723585 |
cggccctcgaggcccaaaggtaaaaaaaatactctaaatata-atataac-tatatataactttatttcaatcttttgatagtttcaatttgaat-ggaa |
7723681 |
T |
 |
| Q |
213 |
ttacagtcactatgcaatgcatgtgggatcagattcaagaaggaagagagaagagcaacttctgccgccggcacagcgac |
292 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
7723682 |
ttacagtcattatgcaatgcatgtgggatcagattcaagaaggaagagagaagagcaacttctgccgctggcacagcgac |
7723761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 202 - 268
Target Start/End: Complemental strand, 32956086 - 32956020
Alignment:
| Q |
202 |
ttgaatgggaattacagtcactatgcaatgcatgtgggatcagattcaagaaggaagagagaagagc |
268 |
Q |
| |
|
|||||| | |||| ||||||||||||||||| |||||||| |||| ||||||||||||||||||||| |
|
|
| T |
32956086 |
ttgaattgaaattgcagtcactatgcaatgcttgtgggattagatacaagaaggaagagagaagagc |
32956020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 45 - 133
Target Start/End: Complemental strand, 32956410 - 32956322
Alignment:
| Q |
45 |
aacaatgattctcttcttgctcgtagatgtgcaaactgtgacaccacctccacaccgctttggaggaacggccctcgaggcccaaaggt |
133 |
Q |
| |
|
|||||||||||||||||||||||| | ||||| | ||||||| |||| || ||||| ||||||||||| || ||||| ||||| ||||| |
|
|
| T |
32956410 |
aacaatgattctcttcttgctcgtcgttgtgctagctgtgactccacttctacacccctttggaggaatggtcctcgtggccctaaggt |
32956322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University