View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14816_high_13 (Length: 204)
Name: NF14816_high_13
Description: NF14816
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14816_high_13 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 129; Significance: 6e-67; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 35 - 188
Target Start/End: Complemental strand, 29656596 - 29656439
Alignment:
| Q |
35 |
gtcattgaaatactattctgctagaagctgcttataagagagaagtaaaatggaaattagagcatat----tacgtcaaagaatgctctagactagacat |
130 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
29656596 |
gtcattgaaatactattctgctagaagctgcttataagagaaaagtaaaatggaaattagagcatataaattacgtcaaagaatgctctagactagacat |
29656497 |
T |
|
| Q |
131 |
atatagccaatgaaaataacccattaatgaagatggtgtatccatttaggttgatctg |
188 |
Q |
| |
|
||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
29656496 |
atatagccaatgaaaataaccgattaacgaagatggtgtatccatttaggttgatctg |
29656439 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University