View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14817_low_17 (Length: 204)
Name: NF14817_low_17
Description: NF14817
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14817_low_17 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 157; Significance: 1e-83; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 14 - 187
Target Start/End: Original strand, 40894964 - 40895141
Alignment:
| Q |
14 |
atcatatagtaggctagtattaggagtctgaccttaattcactttg----cttgttatttgtatcttggattcgtaacaagtttggattgttttgcccaa |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
40894964 |
atcatatagtaggctagtattaggagtctgaccttaattcactttgtttgcttgttatttgtatcttggattcgaaacaagtttggattgttttgcccaa |
40895063 |
T |
|
| Q |
110 |
taaatgctttttgttcttctttccctcgcttattatgggtatcttgttctttcctatgattagtaagagtggcattgt |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40895064 |
taaatgctttttgttcttctttccctcgcttattatgggtatcttgttctttcctatgattagtaagagtggcattgt |
40895141 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 70 - 118
Target Start/End: Complemental strand, 40897975 - 40897927
Alignment:
| Q |
70 |
gtatcttggattcgtaacaagtttggattgttttgcccaataaatgctt |
118 |
Q |
| |
|
|||||||||||| |||||||||||||||| || ||||||| ||||||| |
|
|
| T |
40897975 |
gtatcttggatttgtaacaagtttggattattatgcccaaataatgctt |
40897927 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University