View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14818_high_3 (Length: 284)
Name: NF14818_high_3
Description: NF14818
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14818_high_3 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 1 - 272
Target Start/End: Original strand, 33540548 - 33540819
Alignment:
| Q |
1 |
acatccaaaatttaaattaaagtctaaattattgtgttcaccttaatattactctgaatcacttagcactgaccgctcaattattaaatgtctgaattta |
100 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33540548 |
acatccaaaatttaaattaaagtcgtaattattgtgttcactttaattttactctgaatcacttagcactgaccgctcaattattaaatgtctgaattta |
33540647 |
T |
 |
| Q |
101 |
actttgagcttgtgaaaattcctaggaaaataattatattctcttttgcaagcaaaagccaaagaaatagtagaaaacgattgagggtgtaagtgggttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33540648 |
actttgagcttgtgaaaattcctaggaaaataattatattctcttttgcaagcaaaagccaaagaaatagtagaaaacgattgagggtgtaagtgggttt |
33540747 |
T |
 |
| Q |
201 |
gcaaatattcccaccttttaaataatctttcatctttatgtctcattattaagctttcaattagatattggg |
272 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||| ||||| |
|
|
| T |
33540748 |
gcaaatattcccaccttttaaataatccttcatctttatgtctcattattaagctatcaattagattttggg |
33540819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University