View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14818_high_9 (Length: 204)
Name: NF14818_high_9
Description: NF14818
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14818_high_9 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 178; Significance: 3e-96; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 178; E-Value: 3e-96
Query Start/End: Original strand, 3 - 188
Target Start/End: Original strand, 47460164 - 47460349
Alignment:
| Q |
3 |
gacgacttttacttctctgttgtctccgacgatgaaattgaccctaacgtccctgtctccgatgacaagtacgctgaagcattacagtttcaagaaacct |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47460164 |
gacgacttttacttctctgttgtctccgacgatgaaattgaccctaacgttcctgtctccgatgacaagtacgctgaagcattacagtttcaagaaacct |
47460263 |
T |
|
| Q |
103 |
tattggcctctgtcatcacttctcaccaaaacccttcatcctcttccttcttggcaccaccacgttcattaccatgcgtagcatct |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
47460264 |
tattggcctctgtcatcacttctcaccaaaacccttcatcctcttccttcttggcaccaccacattcattaccatgcgtagcatct |
47460349 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 68; E-Value: 1e-30
Query Start/End: Original strand, 56 - 135
Target Start/End: Original strand, 47466821 - 47466900
Alignment:
| Q |
56 |
tgtctccgatgacaagtacgctgaagcattacagtttcaagaaaccttattggcctctgtcatcacttctcaccaaaacc |
135 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
47466821 |
tgtctccgatgacaagtacgctgaagcattacagttccaagaaaccttaatggcctctgccatcacttctcaccaaaacc |
47466900 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University