View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14818_low_15 (Length: 223)
Name: NF14818_low_15
Description: NF14818
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14818_low_15 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 111; Significance: 3e-56; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 111; E-Value: 3e-56
Query Start/End: Original strand, 66 - 204
Target Start/End: Complemental strand, 28320499 - 28320361
Alignment:
| Q |
66 |
tatcgtttatttaaatcctacaaagcttaagatattagtctttgcagttgttcgtggaaatgatatctgatttacgctaaaaaataaaatatcatttctc |
165 |
Q |
| |
|
|||||||||||| ||||||||||| || ||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28320499 |
tatcgtttatttgaatcctacaaaatttgtgatattaatctttgcagttgatcgtggaaatgatatctgatttacgctaaaaaataaaatatcatttctc |
28320400 |
T |
 |
| Q |
166 |
ataaaagttaagggaaatatggagattcttactccattt |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28320399 |
ataaaagttaagggaaatatggagattcttactccattt |
28320361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University