View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14818_low_16 (Length: 217)
Name: NF14818_low_16
Description: NF14818
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14818_low_16 |
 |  |
|
| [»] scaffold0072 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0072 (Bit Score: 119; Significance: 6e-61; HSPs: 1)
Name: scaffold0072
Description:
Target: scaffold0072; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 9 - 143
Target Start/End: Complemental strand, 41980 - 41846
Alignment:
| Q |
9 |
tgtccaagaaaatcgtgatagcaataccctgaatttgaccgtggaaccgcatggtgcctttacgagcagaaccgttcaaggcattcagtgacaagtggta |
108 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41980 |
tgtccaacaaaatcgtgatagcaataccctgaatttgactgtggaaccgcatggtgcctttacgagcagaaccgttcaaggcattcagtgacaagtggtg |
41881 |
T |
 |
| Q |
109 |
ctcctccgtaacaataggtggtgtatcagggtcag |
143 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |
|
|
| T |
41880 |
ctcctccgtaacaataggtggtgtttcagggtcag |
41846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University