View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14819_high_18 (Length: 475)
Name: NF14819_high_18
Description: NF14819
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14819_high_18 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 186; Significance: 1e-100; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 186; E-Value: 1e-100
Query Start/End: Original strand, 262 - 471
Target Start/End: Original strand, 15020637 - 15020845
Alignment:
| Q |
262 |
actgaaaattgaccttaaaattttgatcattaacattgttattattagtaccaaacaaagaactgttccaacaaatctggatgtatggaaaattccaatt |
361 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15020637 |
actgaaaattgaccttaaaattatgatcattaacattgttattattagtaccaaacaaagaactgttccaacaaatctggatgtatggaaaattccaatt |
15020736 |
T |
|
| Q |
362 |
atgctgagcttctgacatgtgtactcattcacgagagattcaagtgttactcttctttgtggtggatacaagatggaaattgggaggcatgagagggttt |
461 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
15020737 |
atgctgagcttctgacatgtgtactcattcacgagagattcaagtgttacatttc-ttgtggtggatacaagatggaaattgggaggcatgagagggatt |
15020835 |
T |
|
| Q |
462 |
tgtttctttt |
471 |
Q |
| |
|
|||||||||| |
|
|
| T |
15020836 |
tgtttctttt |
15020845 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 78; E-Value: 4e-36
Query Start/End: Original strand, 119 - 233
Target Start/End: Original strand, 15020480 - 15020605
Alignment:
| Q |
119 |
ctgtagaccactggattgtgtggatataatttacatgtacgttagttcagcacagagc------------caggccctcagggagggtacatctgaattt |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| || |
|
|
| T |
15020480 |
ctgtagaccactggattgtgtggatataatttacatgtacgttagttcagcacagagccaggcagagaggcaggccctcagggagggtacatctgaa-tt |
15020578 |
T |
|
| Q |
207 |
ttgttggaacataacatgccaactcac |
233 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
15020579 |
ttgttggaacataacatgccaactcac |
15020605 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University