View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14819_high_32 (Length: 377)

Name: NF14819_high_32
Description: NF14819
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14819_high_32
NF14819_high_32
[»] chr2 (99 HSPs)
chr2 (43-228)||(361906-362091)
chr2 (228-357)||(16419458-16419588)
chr2 (229-357)||(5711674-5711802)
chr2 (229-347)||(2029736-2029854)
chr2 (229-347)||(14466409-14466527)
chr2 (229-357)||(2029960-2030089)
chr2 (229-357)||(5711438-5711567)
chr2 (228-348)||(40379207-40379327)
chr2 (229-347)||(40379443-40379561)
chr2 (229-347)||(17719367-17719485)
chr2 (229-347)||(37840304-37840422)
chr2 (229-347)||(28407792-28407910)
chr2 (235-348)||(2324206-2324319)
chr2 (229-361)||(15124547-15124680)
chr2 (243-347)||(32884074-32884178)
chr2 (231-354)||(17854693-17854816)
chr2 (229-348)||(27897605-27897723)
chr2 (234-348)||(2324440-2324554)
chr2 (230-348)||(29718294-29718412)
chr2 (231-348)||(17854930-17855047)
chr2 (231-347)||(19191611-19191727)
chr2 (240-347)||(17525349-17525455)
chr2 (227-347)||(5851678-5851802)
chr2 (229-343)||(14927073-14927187)
chr2 (228-361)||(25082535-25082669)
chr2 (231-348)||(40149004-40149121)
chr2 (231-357)||(27036416-27036539)
chr2 (277-349)||(37812545-37812617)
chr2 (228-347)||(42639612-42639731)
chr2 (277-347)||(4662198-4662268)
chr2 (230-347)||(21591748-21591866)
chr2 (231-348)||(33606056-33606172)
chr2 (277-357)||(37812315-37812396)
chr2 (231-347)||(12343751-12343867)
chr2 (235-347)||(37769948-37770060)
chr2 (231-345)||(5509048-5509162)
chr2 (250-348)||(16533513-16533611)
chr2 (230-348)||(17525099-17525217)
chr2 (235-348)||(5509279-5509392)
chr2 (230-347)||(32356353-32356469)
chr2 (229-353)||(36351924-36352049)
chr2 (229-348)||(31700744-31700866)
chr2 (235-347)||(40718212-40718324)
chr2 (265-347)||(94055-94137)
chr2 (229-347)||(35418413-35418531)
chr2 (229-353)||(93121-93245)
chr2 (231-347)||(13486300-13486417)
chr2 (228-305)||(17719575-17719652)
chr2 (231-348)||(36316052-36316169)
chr2 (229-312)||(36352158-36352241)
chr2 (229-348)||(9927875-9927996)
chr2 (228-309)||(19570972-19571053)
chr2 (228-341)||(24395837-24395949)
chr2 (229-320)||(19544370-19544460)
chr2 (265-347)||(3738900-3738982)
chr2 (229-310)||(33606288-33606369)
chr2 (231-347)||(8424855-8424971)
chr2 (290-357)||(14466235-14466303)
chr2 (228-316)||(14927291-14927379)
chr2 (251-343)||(38629812-38629904)
chr2 (229-347)||(15124782-15124901)
chr2 (229-303)||(15988423-15988498)
chr2 (281-347)||(25313564-25313631)
chr2 (251-353)||(24396061-24396163)
chr2 (231-288)||(27897504-27897561)
chr2 (229-347)||(40149235-40149343)
chr2 (230-295)||(21383284-21383351)
chr2 (248-315)||(15464768-15464835)
chr2 (265-348)||(18607044-18607127)
chr2 (229-299)||(10570985-10571055)
chr2 (229-315)||(11020557-11020643)
chr2 (229-287)||(16419294-16419352)
chr2 (231-320)||(10523013-10523102)
chr2 (229-306)||(13210534-13210611)
chr2 (231-343)||(10523224-10523336)
chr2 (284-348)||(15518726-15518790)
chr2 (229-309)||(30006578-30006658)
chr2 (229-309)||(30063266-30063346)
chr2 (231-303)||(31008572-31008644)
chr2 (229-307)||(8227356-8227434)
chr2 (229-270)||(93626-93667)
chr2 (231-312)||(5594242-5594323)
chr2 (231-304)||(31222531-31222604)
chr2 (247-303)||(93737-93793)
chr2 (283-343)||(11099656-11099716)
chr2 (277-348)||(24666279-24666351)
chr2 (7-42)||(362156-362191)
chr2 (227-298)||(5450487-5450558)
chr2 (268-343)||(44404196-44404271)
chr2 (265-303)||(93482-93520)
chr2 (235-313)||(1926446-1926524)
chr2 (293-347)||(19544313-19544367)
chr2 (229-270)||(93353-93394)
chr2 (282-311)||(4431657-4431686)
chr2 (240-305)||(9952094-9952158)
chr2 (265-309)||(15988218-15988262)
chr2 (231-271)||(30701126-30701166)
chr2 (320-348)||(38021001-38021029)
chr2 (277-353)||(44403973-44404049)
[»] chr1 (119 HSPs)
chr1 (43-226)||(4383028-4383211)
chr1 (229-361)||(35772216-35772349)
chr1 (229-347)||(4113005-4113123)
chr1 (229-342)||(40079124-40079237)
chr1 (229-353)||(26177104-26177228)
chr1 (228-353)||(2859390-2859515)
chr1 (229-347)||(17452827-17452945)
chr1 (229-353)||(4112539-4112663)
chr1 (227-347)||(15986330-15986450)
chr1 (229-353)||(25713354-25713478)
chr1 (228-347)||(52650769-52650888)
chr1 (229-347)||(20208527-20208643)
chr1 (229-347)||(26176875-26176993)
chr1 (232-357)||(52961538-52961664)
chr1 (231-340)||(17452680-17452789)
chr1 (229-349)||(25145719-25145839)
chr1 (231-347)||(51588959-51589075)
chr1 (228-347)||(26865356-26865475)
chr1 (231-348)||(3169732-3169849)
chr1 (227-347)||(41035824-41035944)
chr1 (231-346)||(25137304-25137419)
chr1 (229-351)||(39348118-39348240)
chr1 (231-353)||(51589187-51589309)
chr1 (229-357)||(25145484-25145613)
chr1 (235-347)||(38080572-38080683)
chr1 (229-347)||(8870909-8871032)
chr1 (228-348)||(16163133-16163255)
chr1 (229-347)||(2859626-2859744)
chr1 (229-343)||(31181512-31181626)
chr1 (229-347)||(42586438-42586555)
chr1 (229-357)||(51459704-51459833)
chr1 (231-347)||(26173457-26173573)
chr1 (229-348)||(855947-856066)
chr1 (229-348)||(38733348-38733467)
chr1 (228-348)||(27413548-27413668)
chr1 (229-347)||(35772002-35772114)
chr1 (229-347)||(30369802-30369920)
chr1 (229-335)||(39348352-39348457)
chr1 (229-347)||(43409774-43409891)
chr1 (229-314)||(38668125-38668210)
chr1 (231-315)||(51589805-51589889)
chr1 (231-347)||(52127688-52127803)
chr1 (229-352)||(4098162-4098285)
chr1 (229-348)||(35892257-35892376)
chr1 (265-357)||(4112805-4112899)
chr1 (229-343)||(21626338-21626452)
chr1 (243-347)||(12244975-12245079)
chr1 (244-348)||(38668326-38668430)
chr1 (229-309)||(49142958-49143038)
chr1 (229-348)||(7653442-7653561)
chr1 (230-348)||(4098403-4098520)
chr1 (229-344)||(26173229-26173335)
chr1 (227-309)||(32223768-32223850)
chr1 (229-295)||(33156752-33156818)
chr1 (282-348)||(51459882-51459948)
chr1 (244-348)||(3169966-3170071)
chr1 (229-345)||(16162902-16163018)
chr1 (240-343)||(17468315-17468419)
chr1 (231-357)||(51589996-51590121)
chr1 (229-348)||(7307687-7307806)
chr1 (229-348)||(27413313-27413432)
chr1 (229-343)||(3477175-3477289)
chr1 (229-347)||(25255279-25255396)
chr1 (234-347)||(28408043-28408159)
chr1 (229-295)||(31432229-31432295)
chr1 (240-346)||(39808434-39808539)
chr1 (231-309)||(40316051-40316129)
chr1 (231-309)||(52907389-52907467)
chr1 (277-357)||(8870736-8870817)
chr1 (235-347)||(11924888-11925000)
chr1 (229-320)||(29898906-29898997)
chr1 (229-347)||(17402549-17402667)
chr1 (295-353)||(17412528-17412586)
chr1 (229-343)||(26346968-26347081)
chr1 (229-299)||(29265968-29266038)
chr1 (229-347)||(32952038-32952156)
chr1 (229-347)||(38733119-38733236)
chr1 (282-347)||(13386215-13386280)
chr1 (240-309)||(31004447-31004516)
chr1 (294-347)||(35303504-35303557)
chr1 (282-357)||(51460133-51460210)
chr1 (231-339)||(9499221-9499328)
chr1 (241-321)||(17402707-17402787)
chr1 (229-305)||(33157230-33157306)
chr1 (229-309)||(42351859-42351939)
chr1 (240-307)||(11234223-11234290)
chr1 (229-320)||(49142502-49142593)
chr1 (229-347)||(32783280-32783397)
chr1 (297-347)||(33156405-33156455)
chr1 (286-348)||(51460263-51460325)
chr1 (297-357)||(33156925-33156986)
chr1 (230-315)||(34264710-34264795)
chr1 (229-306)||(40188984-40189061)
chr1 (282-346)||(369603-369667)
chr1 (267-343)||(7826068-7826144)
chr1 (247-347)||(26603395-26603495)
chr1 (229-305)||(50695833-50695909)
chr1 (7-42)||(4382929-4382964)
chr1 (241-343)||(22100053-22100156)
chr1 (229-304)||(22377542-22377617)
chr1 (229-307)||(11525004-11525082)
chr1 (251-353)||(12488987-12489089)
chr1 (266-307)||(7465681-7465722)
chr1 (285-346)||(17412304-17412365)
chr1 (229-266)||(51460049-51460086)
chr1 (246-357)||(9146570-9146682)
chr1 (241-309)||(26229573-26229641)
chr1 (229-309)||(41066944-41067024)
chr1 (231-307)||(51460443-51460519)
chr1 (230-289)||(12376673-12376732)
chr1 (234-309)||(16173210-16173283)
chr1 (250-312)||(9830582-9830644)
chr1 (229-263)||(20208228-20208262)
chr1 (229-275)||(31496370-31496416)
chr1 (229-310)||(5109488-5109569)
chr1 (229-306)||(9146863-9146940)
chr1 (230-307)||(11525219-11525296)
chr1 (282-354)||(31496189-31496260)
chr1 (229-304)||(39544406-39544479)
[»] chr4 (118 HSPs)
chr4 (227-357)||(35788851-35788981)
chr4 (229-348)||(39902562-39902681)
chr4 (229-347)||(35788626-35788744)
chr4 (228-347)||(22845445-22845564)
chr4 (231-357)||(21498751-21498878)
chr4 (227-357)||(35796739-35796870)
chr4 (229-343)||(22827509-22827623)
chr4 (231-353)||(28245527-28245649)
chr4 (229-347)||(50543566-50543684)
chr4 (227-347)||(22863441-22863561)
chr4 (229-348)||(22231072-22231191)
chr4 (229-348)||(22231307-22231426)
chr4 (229-347)||(1518131-1518249)
chr4 (231-353)||(9685593-9685715)
chr4 (229-347)||(52559534-52559652)
chr4 (229-357)||(6218395-6218524)
chr4 (229-357)||(50543329-50543458)
chr4 (231-347)||(21498321-21498437)
chr4 (229-347)||(21684965-21685083)
chr4 (229-347)||(53828522-53828640)
chr4 (231-348)||(20821939-20822056)
chr4 (229-361)||(52559756-52559889)
chr4 (229-357)||(53828288-53828417)
chr4 (231-347)||(25052819-25052935)
chr4 (229-345)||(37836049-37836165)
chr4 (229-348)||(35796976-35797095)
chr4 (231-357)||(54054806-54054932)
chr4 (240-357)||(5398222-5398338)
chr4 (242-347)||(9279194-9279299)
chr4 (231-347)||(14783188-14783304)
chr4 (277-353)||(27634128-27634204)
chr4 (231-347)||(53814930-53815046)
chr4 (229-348)||(11036510-11036629)
chr4 (229-347)||(11036745-11036863)
chr4 (265-347)||(27634551-27634633)
chr4 (229-357)||(5398475-5398603)
chr4 (231-347)||(5846113-5846229)
chr4 (244-347)||(35645779-35645882)
chr4 (229-348)||(40717440-40717559)
chr4 (229-347)||(35819127-35819245)
chr4 (229-343)||(44118858-44118972)
chr4 (228-357)||(17111725-17111854)
chr4 (228-345)||(35175004-35175120)
chr4 (231-347)||(400566-400682)
chr4 (231-347)||(9685365-9685481)
chr4 (229-316)||(34358029-34358116)
chr4 (228-357)||(12869027-12869157)
chr4 (246-348)||(31254423-31254525)
chr4 (231-316)||(2463804-2463889)
chr4 (229-357)||(35609489-35609618)
chr4 (229-353)||(2516162-2516284)
chr4 (229-348)||(36685874-36685992)
chr4 (229-343)||(6218175-6218289)
chr4 (231-341)||(53814675-53814785)
chr4 (229-314)||(12869262-12869347)
chr4 (231-316)||(16066063-16066148)
chr4 (254-343)||(27464272-27464361)
chr4 (230-348)||(45784870-45784996)
chr4 (265-353)||(5846340-5846428)
chr4 (282-357)||(40717258-40717334)
chr4 (229-353)||(18528216-18528340)
chr4 (229-356)||(25323797-25323925)
chr4 (272-347)||(980092-980167)
chr4 (229-345)||(10361998-10362116)
chr4 (235-357)||(21750047-21750170)
chr4 (255-314)||(28246110-28246169)
chr4 (265-347)||(13555502-13555584)
chr4 (229-311)||(28073180-28073262)
chr4 (229-307)||(35609710-35609788)
chr4 (229-299)||(53559289-53559359)
chr4 (250-343)||(53698998-53699091)
chr4 (270-347)||(54055072-54055149)
chr4 (229-353)||(13555246-13555370)
chr4 (229-301)||(40726734-40726806)
chr4 (265-347)||(6778696-6778779)
chr4 (228-343)||(7926529-7926644)
chr4 (241-343)||(7926299-7926401)
chr4 (265-357)||(7806616-7806709)
chr4 (231-348)||(11103897-11104014)
chr4 (231-335)||(26549615-26549720)
chr4 (240-297)||(35645696-35645753)
chr4 (243-343)||(12005482-12005582)
chr4 (229-305)||(17111573-17111648)
chr4 (229-347)||(22445415-22445537)
chr4 (240-344)||(30566044-30566148)
chr4 (231-346)||(2261754-2261869)
chr4 (229-308)||(22822356-22822435)
chr4 (231-302)||(24513361-24513431)
chr4 (228-315)||(41187930-41188017)
chr4 (249-348)||(42662429-42662528)
chr4 (229-299)||(6666634-6666704)
chr4 (249-347)||(11783811-11783909)
chr4 (229-315)||(21646500-21646586)
chr4 (229-307)||(50870480-50870557)
chr4 (231-336)||(13637367-13637472)
chr4 (240-297)||(35645407-35645464)
chr4 (298-357)||(6778511-6778571)
chr4 (241-309)||(30529937-30530005)
chr4 (246-305)||(17222668-17222727)
chr4 (231-302)||(24513140-24513211)
chr4 (228-307)||(42684791-42684870)
chr4 (257-315)||(7892547-7892605)
chr4 (229-347)||(18528456-18528574)
chr4 (243-309)||(35485232-35485298)
chr4 (250-307)||(6666220-6666277)
chr4 (265-309)||(2221003-2221047)
chr4 (229-309)||(21646264-21646344)
chr4 (229-305)||(43742998-43743074)
chr4 (229-315)||(4464291-4464380)
chr4 (282-341)||(32333962-32334021)
chr4 (229-307)||(50828207-50828285)
chr4 (244-309)||(20726838-20726903)
chr4 (228-305)||(31039345-31039416)
chr4 (240-344)||(13611759-13611863)
chr4 (241-340)||(20253484-20253584)
chr4 (229-309)||(21041356-21041436)
chr4 (253-293)||(52146088-52146128)
chr4 (250-306)||(53698802-53698858)
[»] chr6 (89 HSPs)
chr6 (228-361)||(17147658-17147792)
chr6 (229-357)||(4868576-4868705)
chr6 (229-347)||(13353168-13353286)
chr6 (229-347)||(33796293-33796411)
chr6 (229-347)||(4868812-4868930)
chr6 (228-357)||(9705210-9705340)
chr6 (229-347)||(9704987-9705105)
chr6 (231-357)||(27656415-27656541)
chr6 (229-347)||(33494506-33494624)
chr6 (231-347)||(12330292-12330407)
chr6 (229-345)||(25065093-25065209)
chr6 (231-345)||(30256782-30256895)
chr6 (229-348)||(19712918-19713037)
chr6 (229-347)||(6542942-6543060)
chr6 (231-349)||(8026354-8026472)
chr6 (231-349)||(21690687-21690805)
chr6 (231-340)||(12330180-12330289)
chr6 (240-353)||(6400630-6400743)
chr6 (231-347)||(27653184-27653300)
chr6 (231-347)||(27772681-27772797)
chr6 (235-357)||(12329949-12330072)
chr6 (241-347)||(2753225-2753331)
chr6 (245-347)||(28867972-28868074)
chr6 (230-348)||(30256544-30256662)
chr6 (229-357)||(2736166-2736295)
chr6 (231-348)||(27772912-27773029)
chr6 (231-347)||(8566960-8567075)
chr6 (229-312)||(11721907-11721990)
chr6 (229-348)||(19639112-19639231)
chr6 (227-353)||(6054364-6054490)
chr6 (227-345)||(13740885-13741003)
chr6 (227-345)||(13746385-13746503)
chr6 (232-357)||(5572386-5572511)
chr6 (231-348)||(15081909-15082026)
chr6 (231-347)||(24554084-24554200)
chr6 (229-315)||(3680011-3680097)
chr6 (258-347)||(6400874-6400963)
chr6 (231-347)||(2736403-2736519)
chr6 (229-361)||(5648671-5648803)
chr6 (229-306)||(19712722-19712801)
chr6 (234-341)||(16722811-16722918)
chr6 (229-347)||(11085548-11085666)
chr6 (250-347)||(4906773-4906870)
chr6 (277-357)||(3680203-3680283)
chr6 (229-347)||(7915817-7915934)
chr6 (229-344)||(12199803-12199919)
chr6 (240-347)||(2737180-2737287)
chr6 (229-348)||(6542708-6542826)
chr6 (229-343)||(16570130-16570244)
chr6 (251-348)||(33494740-33494838)
chr6 (229-334)||(3713322-3713427)
chr6 (231-348)||(5572617-5572733)
chr6 (231-296)||(8026622-8026687)
chr6 (241-333)||(33631816-33631907)
chr6 (229-299)||(6623409-6623479)
chr6 (282-348)||(7638642-7638708)
chr6 (229-306)||(8001549-8001626)
chr6 (297-357)||(13353392-13353453)
chr6 (297-357)||(33796517-33796578)
chr6 (231-315)||(13740680-13740764)
chr6 (231-315)||(13746180-13746264)
chr6 (284-348)||(31961144-31961208)
chr6 (229-348)||(10145749-10145868)
chr6 (233-348)||(32290929-32291043)
chr6 (249-343)||(3823275-3823369)
chr6 (277-347)||(12199732-12199802)
chr6 (253-347)||(15600903-15600997)
chr6 (282-347)||(6369431-6369496)
chr6 (247-352)||(21214947-21215052)
chr6 (265-353)||(30505698-30505787)
chr6 (240-315)||(6065976-6066049)
chr6 (268-347)||(6237740-6237819)
chr6 (265-340)||(15102966-15103041)
chr6 (229-344)||(30849401-30849516)
chr6 (231-313)||(15082145-15082226)
chr6 (228-320)||(4161844-4161937)
chr6 (228-320)||(4223464-4223557)
chr6 (229-347)||(6054136-6054254)
chr6 (241-307)||(7333093-7333159)
chr6 (277-347)||(11085780-11085850)
chr6 (265-346)||(467579-467660)
chr6 (263-348)||(3712996-3713081)
chr6 (283-343)||(12319727-12319787)
chr6 (231-347)||(12885021-12885140)
chr6 (229-301)||(20373584-20373655)
chr6 (229-306)||(4148784-4148861)
chr6 (306-347)||(30505470-30505511)
chr6 (242-306)||(5609133-5609197)
chr6 (257-309)||(33631638-33631690)
[»] chr5 (108 HSPs)
chr5 (228-357)||(41666755-41666885)
chr5 (229-357)||(24346500-24346629)
chr5 (229-357)||(8081112-8081242)
chr5 (229-347)||(41666992-41667110)
chr5 (229-357)||(24269870-24269998)
chr5 (228-357)||(95264-95394)
chr5 (227-348)||(19705869-19705990)
chr5 (229-357)||(18333464-18333592)
chr5 (229-347)||(2063733-2063850)
chr5 (229-357)||(43117838-43117967)
chr5 (229-348)||(15480523-15480644)
chr5 (229-347)||(24531567-24531684)
chr5 (229-343)||(28510062-28510176)
chr5 (231-357)||(27132994-27133121)
chr5 (230-347)||(9368562-9368679)
chr5 (229-357)||(9368786-9368915)
chr5 (229-341)||(15480295-15480407)
chr5 (228-348)||(17352433-17352552)
chr5 (229-347)||(24346736-24346854)
chr5 (229-347)||(24528508-24528625)
chr5 (229-357)||(20510641-20510770)
chr5 (232-349)||(24647661-24647778)
chr5 (265-361)||(30770084-30770181)
chr5 (231-347)||(8098285-8098400)
chr5 (231-347)||(21209922-21210038)
chr5 (226-357)||(38731599-38731730)
chr5 (229-345)||(13701067-13701183)
chr5 (229-340)||(21306861-21306972)
chr5 (229-340)||(21314699-21314810)
chr5 (229-343)||(1564566-1564680)
chr5 (235-353)||(6637798-6637916)
chr5 (229-347)||(25258300-25258418)
chr5 (229-347)||(25322090-25322208)
chr5 (229-357)||(13296848-13296977)
chr5 (231-347)||(6413658-6413773)
chr5 (229-344)||(18333698-18333814)
chr5 (229-347)||(33337454-33337568)
chr5 (231-347)||(42295546-42295662)
chr5 (245-340)||(6413441-6413536)
chr5 (229-348)||(12034656-12034775)
chr5 (231-357)||(26137110-26137237)
chr5 (265-340)||(30758334-30758409)
chr5 (229-347)||(17352667-17352785)
chr5 (231-348)||(24487646-24487763)
chr5 (228-329)||(35167393-35167494)
chr5 (229-357)||(32908717-32908845)
chr5 (231-347)||(37782051-37782167)
chr5 (240-343)||(7369695-7369798)
chr5 (229-347)||(24270105-24270223)
chr5 (231-349)||(29909722-29909841)
chr5 (231-345)||(8287771-8287884)
chr5 (229-299)||(25258093-25258163)
chr5 (229-299)||(25321883-25321953)
chr5 (228-309)||(60092-60173)
chr5 (253-341)||(2061961-2062049)
chr5 (235-347)||(6637570-6637680)
chr5 (229-348)||(13700588-13700708)
chr5 (234-357)||(29909491-29909615)
chr5 (265-348)||(6919229-6919312)
chr5 (255-353)||(8098512-8098610)
chr5 (229-315)||(15438986-15439072)
chr5 (265-347)||(30770300-30770382)
chr5 (229-331)||(38731837-38731939)
chr5 (229-314)||(13296673-13296757)
chr5 (229-334)||(38976913-38977018)
chr5 (248-348)||(3859326-3859426)
chr5 (231-347)||(7607561-7607677)
chr5 (234-338)||(16707029-16707133)
chr5 (229-353)||(33337237-33337361)
chr5 (231-315)||(37656938-37657022)
chr5 (242-309)||(170563-170630)
chr5 (277-359)||(17150280-17150363)
chr5 (231-357)||(19522277-19522403)
chr5 (231-334)||(20225021-20225124)
chr5 (282-348)||(4481615-4481681)
chr5 (241-335)||(15438856-15438950)
chr5 (241-357)||(17015890-17016003)
chr5 (229-348)||(18885428-18885548)
chr5 (231-316)||(19522085-19522170)
chr5 (229-320)||(2986011-2986102)
chr5 (244-357)||(15590129-15590244)
chr5 (241-348)||(37405055-37405162)
chr5 (229-347)||(6919428-6919544)
chr5 (230-347)||(26137345-26137463)
chr5 (242-343)||(7092121-7092221)
chr5 (292-353)||(24528736-24528797)
chr5 (229-329)||(16571459-16571559)
chr5 (229-345)||(36040475-36040591)
chr5 (229-311)||(18140861-18140943)
chr5 (305-347)||(38976873-38976915)
chr5 (277-353)||(2985275-2985352)
chr5 (277-357)||(11895963-11896043)
chr5 (284-348)||(13358367-13358431)
chr5 (277-345)||(31181058-31181126)
chr5 (265-347)||(37656582-37656662)
chr5 (308-354)||(26245943-26245989)
chr5 (266-347)||(17017127-17017208)
chr5 (244-309)||(17899474-17899539)
chr5 (231-263)||(1028399-1028431)
chr5 (277-345)||(11896732-11896800)
chr5 (249-348)||(17584139-17584238)
chr5 (231-290)||(21209709-21209768)
chr5 (231-306)||(34328919-34328994)
chr5 (243-343)||(7104239-7104338)
chr5 (241-291)||(31974239-31974289)
chr5 (245-307)||(31974443-31974505)
chr5 (256-309)||(25436206-25436259)
chr5 (229-281)||(9187319-9187371)
[»] scaffold0519 (2 HSPs)
scaffold0519 (229-357)||(2107-2236)
scaffold0519 (229-347)||(1883-2001)
[»] chr8 (124 HSPs)
chr8 (229-357)||(11232193-11232322)
chr8 (229-347)||(11232428-11232546)
chr8 (228-357)||(39960148-39960278)
chr8 (229-357)||(35682780-35682909)
chr8 (229-348)||(5931948-5932067)
chr8 (228-347)||(10449967-10450086)
chr8 (229-347)||(24532420-24532538)
chr8 (229-347)||(39052928-39053046)
chr8 (231-357)||(19256587-19256714)
chr8 (231-357)||(17477021-17477148)
chr8 (229-347)||(12317013-12317131)
chr8 (231-347)||(17469785-17469901)
chr8 (231-347)||(19256821-19256937)
chr8 (231-347)||(24075307-24075423)
chr8 (229-340)||(5932183-5932294)
chr8 (229-348)||(15042669-15042788)
chr8 (229-352)||(18004095-18004218)
chr8 (231-357)||(39743485-39743612)
chr8 (229-347)||(25325613-25325731)
chr8 (231-347)||(5590369-5590485)
chr8 (229-349)||(41790624-41790743)
chr8 (232-343)||(4828264-4828375)
chr8 (229-347)||(42846604-42846723)
chr8 (229-343)||(37001435-37001549)
chr8 (231-355)||(422218-422342)
chr8 (231-343)||(4828039-4828151)
chr8 (229-353)||(12688268-12688392)
chr8 (229-347)||(3157558-3157677)
chr8 (229-348)||(20301227-20301346)
chr8 (229-348)||(21087859-21087978)
chr8 (229-347)||(35385810-35385929)
chr8 (230-340)||(8928991-8929101)
chr8 (245-343)||(38447442-38447540)
chr8 (231-348)||(28069358-28069475)
chr8 (231-347)||(7267466-7267582)
chr8 (231-347)||(34842645-34842761)
chr8 (228-348)||(3157325-3157442)
chr8 (229-343)||(22638178-22638292)
chr8 (227-348)||(12547065-12547185)
chr8 (227-303)||(27205171-27205247)
chr8 (229-340)||(8084101-8084212)
chr8 (228-357)||(8084318-8084448)
chr8 (232-342)||(26800514-26800624)
chr8 (229-303)||(27204975-27205049)
chr8 (229-303)||(27205073-27205147)
chr8 (229-347)||(36917438-36917556)
chr8 (229-316)||(10884062-10884149)
chr8 (250-353)||(34843078-34843181)
chr8 (228-306)||(18939295-18939373)
chr8 (250-347)||(20702763-20702861)
chr8 (229-335)||(29005843-29005949)
chr8 (229-343)||(37001197-37001311)
chr8 (229-307)||(38475754-38475832)
chr8 (231-348)||(34653117-34653233)
chr8 (229-313)||(15042885-15042969)
chr8 (282-357)||(39052589-39052665)
chr8 (228-357)||(3157007-3157137)
chr8 (229-352)||(31197809-31197932)
chr8 (265-343)||(7729912-7729990)
chr8 (229-357)||(20301452-20301592)
chr8 (229-357)||(21088084-21088224)
chr8 (229-309)||(42049686-42049766)
chr8 (245-348)||(16050227-16050329)
chr8 (251-346)||(39984782-39984877)
chr8 (229-307)||(8466723-8466801)
chr8 (241-347)||(31197582-31197688)
chr8 (229-340)||(20515121-20515229)
chr8 (231-348)||(28213105-28213221)
chr8 (231-347)||(16049996-16050112)
chr8 (228-343)||(36907426-36907541)
chr8 (229-315)||(422452-422538)
chr8 (233-335)||(4873694-4873795)
chr8 (229-347)||(5676055-5676173)
chr8 (228-290)||(10454450-10454512)
chr8 (229-343)||(10614938-10615052)
chr8 (284-357)||(20094614-20094688)
chr8 (230-312)||(20094795-20094876)
chr8 (265-343)||(29907761-29907839)
chr8 (229-343)||(30201523-30201637)
chr8 (229-307)||(38476284-38476362)
chr8 (229-353)||(6541875-6542000)
chr8 (231-312)||(8716116-8716197)
chr8 (229-306)||(26208248-26208325)
chr8 (248-347)||(7669386-7669485)
chr8 (265-343)||(6463163-6463241)
chr8 (229-315)||(12688071-12688157)
chr8 (265-347)||(30966102-30966184)
chr8 (277-343)||(34236695-34236761)
chr8 (229-343)||(37868582-37868696)
chr8 (231-280)||(4963388-4963437)
chr8 (228-317)||(31827351-31827440)
chr8 (229-309)||(40014663-40014743)
chr8 (242-306)||(45031373-45031437)
chr8 (252-343)||(5940029-5940120)
chr8 (260-315)||(7669640-7669695)
chr8 (240-353)||(8715862-8715977)
chr8 (230-309)||(15686040-15686119)
chr8 (229-312)||(15797050-15797132)
chr8 (235-346)||(29099745-29099856)
chr8 (229-315)||(36917255-36917342)
chr8 (257-343)||(3961426-3961512)
chr8 (229-335)||(6462938-6463043)
chr8 (240-306)||(6559459-6559525)
chr8 (294-348)||(19472314-19472368)
chr8 (294-348)||(19543239-19543293)
chr8 (294-348)||(19589403-19589457)
chr8 (84-158)||(42720307-42720381)
chr8 (265-343)||(44931217-44931295)
chr8 (229-306)||(16962245-16962322)
chr8 (231-280)||(26208013-26208062)
chr8 (243-316)||(27439560-27439633)
chr8 (265-357)||(37868383-37868476)
chr8 (228-348)||(5675732-5675852)
chr8 (306-357)||(39052770-39052822)
chr8 (229-272)||(24532285-24532328)
chr8 (282-317)||(42584671-42584706)
chr8 (240-306)||(31079809-31079875)
chr8 (229-275)||(38476077-38476123)
chr8 (229-275)||(44694708-44694754)
chr8 (241-290)||(45122369-45122418)
chr8 (229-293)||(10615155-10615219)
chr8 (229-305)||(26482675-26482749)
chr8 (241-309)||(30953015-30953077)
chr8 (271-343)||(31079603-31079675)
[»] chr7 (115 HSPs)
chr7 (228-357)||(21861485-21861615)
chr7 (231-347)||(29469572-29469688)
chr7 (231-357)||(29469796-29469923)
chr7 (229-347)||(21054952-21055070)
chr7 (229-347)||(21861261-21861379)
chr7 (229-348)||(43688159-43688277)
chr7 (229-347)||(47710410-47710528)
chr7 (229-347)||(47722066-47722184)
chr7 (229-348)||(26239915-26240034)
chr7 (231-357)||(34027349-34027476)
chr7 (229-346)||(25620105-25620221)
chr7 (229-348)||(1596794-1596913)
chr7 (229-348)||(36277225-36277344)
chr7 (229-347)||(1596561-1596678)
chr7 (229-357)||(48243060-48243187)
chr7 (229-357)||(31892343-31892472)
chr7 (232-348)||(3392948-3393064)
chr7 (235-347)||(17202146-17202258)
chr7 (229-345)||(33996310-33996426)
chr7 (232-352)||(44874348-44874468)
chr7 (231-347)||(48661556-48661672)
chr7 (228-357)||(2404172-2404301)
chr7 (228-349)||(6634820-6634941)
chr7 (231-348)||(26562074-26562191)
chr7 (229-357)||(34027583-34027712)
chr7 (235-347)||(2544452-2544564)
chr7 (229-348)||(18826487-18826606)
chr7 (229-347)||(3038083-3038201)
chr7 (230-348)||(6001435-6001553)
chr7 (241-347)||(48243448-48243554)
chr7 (229-353)||(4268015-4268140)
chr7 (228-357)||(40746031-40746160)
chr7 (229-357)||(36993073-36993201)
chr7 (227-357)||(3519727-3519853)
chr7 (235-353)||(2544220-2544338)
chr7 (231-357)||(40746455-40746581)
chr7 (251-347)||(46452599-46452696)
chr7 (231-347)||(36206064-36206180)
chr7 (231-338)||(40746241-40746348)
chr7 (229-347)||(2404407-2404525)
chr7 (231-347)||(10903051-10903168)
chr7 (227-348)||(22574802-22574922)
chr7 (234-339)||(32278889-32278994)
chr7 (229-341)||(32879613-32879726)
chr7 (229-357)||(36276990-36277119)
chr7 (235-343)||(11211684-11211791)
chr7 (229-345)||(21821775-21821891)
chr7 (231-347)||(31257268-31257384)
chr7 (245-348)||(25620337-25620440)
chr7 (244-347)||(31892118-31892221)
chr7 (229-346)||(33996078-33996195)
chr7 (229-333)||(4886310-4886414)
chr7 (235-347)||(14540957-14541068)
chr7 (233-335)||(3520042-3520145)
chr7 (231-314)||(10882007-10882089)
chr7 (247-357)||(31485441-31485552)
chr7 (229-316)||(31485658-31485745)
chr7 (229-320)||(43085536-43085627)
chr7 (229-348)||(4267820-4267941)
chr7 (229-347)||(28080632-28080749)
chr7 (229-313)||(6991756-6991840)
chr7 (229-357)||(21821995-21822128)
chr7 (232-343)||(23839079-23839190)
chr7 (229-320)||(43075309-43075400)
chr7 (228-347)||(5522846-5522967)
chr7 (265-347)||(9689125-9689207)
chr7 (231-345)||(31257032-31257146)
chr7 (229-299)||(32474515-32474585)
chr7 (229-347)||(42985122-42985240)
chr7 (229-314)||(4506932-4507017)
chr7 (229-353)||(9688869-9688993)
chr7 (228-348)||(14540739-14540859)
chr7 (229-309)||(15317557-15317637)
chr7 (229-309)||(40898921-40899001)
chr7 (240-343)||(47849763-47849864)
chr7 (229-343)||(1793719-1793831)
chr7 (231-342)||(20305664-20305775)
chr7 (240-343)||(47849542-47849645)
chr7 (229-303)||(1000560-1000634)
chr7 (229-307)||(30727117-30727195)
chr7 (229-347)||(41190981-41191099)
chr7 (241-346)||(26028972-26029077)
chr7 (252-320)||(43089230-43089298)
chr7 (277-348)||(35308193-35308264)
chr7 (231-313)||(1793921-1794003)
chr7 (265-315)||(4454775-4454825)
chr7 (241-315)||(23796034-23796107)
chr7 (244-357)||(27939130-27939244)
chr7 (229-275)||(40121923-40121969)
chr7 (231-292)||(6782883-6782944)
chr7 (235-320)||(32279071-32279156)
chr7 (228-309)||(40898713-40898794)
chr7 (235-310)||(8075863-8075938)
chr7 (260-347)||(22574572-22574659)
chr7 (241-312)||(23796195-23796266)
chr7 (241-343)||(32292489-32292591)
chr7 (229-268)||(33834237-33834276)
chr7 (242-346)||(33834394-33834490)
chr7 (233-307)||(48417518-48417592)
chr7 (231-344)||(2315271-2315384)
chr7 (283-348)||(33515665-33515730)
chr7 (233-357)||(4507122-4507246)
chr7 (240-304)||(40991754-40991818)
chr7 (228-275)||(7786252-7786299)
chr7 (229-263)||(10882238-10882272)
chr7 (231-309)||(22339604-22339682)
chr7 (240-306)||(49117261-49117327)
chr7 (286-343)||(7545734-7545790)
chr7 (235-348)||(14742830-14742943)
chr7 (229-306)||(23794355-23794432)
chr7 (229-274)||(48420741-48420786)
chr7 (235-315)||(2401359-2401439)
chr7 (240-344)||(9625383-9625487)
chr7 (293-345)||(36181030-36181082)
chr7 (229-308)||(44874577-44874657)
[»] chr3 (105 HSPs)
chr3 (229-357)||(35038193-35038322)
chr3 (229-348)||(16239557-16239676)
chr3 (229-347)||(16926948-16927066)
chr3 (229-347)||(54567859-54567977)
chr3 (235-348)||(20327619-20327732)
chr3 (229-348)||(4155525-4155644)
chr3 (229-348)||(54368482-54368601)
chr3 (229-347)||(4155291-4155409)
chr3 (229-347)||(35038427-35038545)
chr3 (229-357)||(31317422-31317551)
chr3 (231-347)||(11589752-11589868)
chr3 (231-347)||(20327850-20327966)
chr3 (229-347)||(1723075-1723192)
chr3 (229-347)||(22729067-22729185)
chr3 (229-353)||(8018929-8019053)
chr3 (229-348)||(20303063-20303182)
chr3 (229-348)||(39620292-39620411)
chr3 (229-347)||(7697397-7697514)
chr3 (229-347)||(12930127-12930245)
chr3 (228-349)||(18757807-18757928)
chr3 (235-347)||(6487338-6487450)
chr3 (231-347)||(9272928-9273044)
chr3 (235-357)||(9273151-9273274)
chr3 (236-347)||(27670398-27670509)
chr3 (229-352)||(39269293-39269416)
chr3 (229-347)||(31317196-31317313)
chr3 (229-357)||(16239783-16239912)
chr3 (229-340)||(45138970-45139081)
chr3 (229-347)||(17638202-17638319)
chr3 (229-357)||(17638364-17638490)
chr3 (231-348)||(39683268-39683386)
chr3 (238-347)||(38791458-38791567)
chr3 (228-343)||(472058-472180)
chr3 (228-339)||(45138800-45138911)
chr3 (228-347)||(34610527-34610647)
chr3 (229-335)||(50083079-50083186)
chr3 (231-309)||(13574922-13575000)
chr3 (254-348)||(23691216-23691310)
chr3 (254-348)||(23708016-23708110)
chr3 (254-348)||(23726472-23726566)
chr3 (254-348)||(23744928-23745022)
chr3 (254-348)||(24063453-24063547)
chr3 (229-343)||(30179707-30179821)
chr3 (227-320)||(43781577-43781670)
chr3 (230-343)||(45828217-45828330)
chr3 (229-349)||(3975357-3975477)
chr3 (229-348)||(23708223-23708342)
chr3 (229-348)||(23726679-23726798)
chr3 (229-348)||(23745135-23745254)
chr3 (231-309)||(50052540-50052619)
chr3 (231-357)||(29215590-29215716)
chr3 (229-343)||(41915142-41915255)
chr3 (229-306)||(45828027-45828104)
chr3 (235-348)||(49629572-49629684)
chr3 (235-314)||(13741106-13741186)
chr3 (231-347)||(17001422-17001538)
chr3 (232-343)||(13574686-13574797)
chr3 (229-292)||(24866219-24866282)
chr3 (229-347)||(27086554-27086675)
chr3 (253-347)||(2123774-2123868)
chr3 (229-315)||(24063660-24063746)
chr3 (240-315)||(1800214-1800289)
chr3 (229-348)||(4008651-4008770)
chr3 (288-347)||(34992517-34992576)
chr3 (229-315)||(23691423-23691509)
chr3 (272-361)||(54368674-54368764)
chr3 (246-307)||(23610387-23610448)
chr3 (229-347)||(28087214-28087336)
chr3 (267-332)||(30138046-30138111)
chr3 (267-332)||(30147597-30147662)
chr3 (232-309)||(33205470-33205547)
chr3 (231-292)||(47702410-47702471)
chr3 (229-309)||(2806285-2806365)
chr3 (229-345)||(21809146-21809262)
chr3 (229-345)||(29575889-29576005)
chr3 (290-357)||(19954278-19954345)
chr3 (231-343)||(50052773-50052879)
chr3 (306-347)||(20303013-20303054)
chr3 (253-309)||(50930707-50930763)
chr3 (231-290)||(11590029-11590088)
chr3 (277-359)||(26753333-26753416)
chr3 (277-348)||(52724033-52724104)
chr3 (242-296)||(14611194-14611248)
chr3 (231-281)||(20303386-20303436)
chr3 (240-306)||(20479016-20479082)
chr3 (227-315)||(37246664-37246749)
chr3 (229-314)||(8142407-8142491)
chr3 (296-344)||(52994748-52994796)
chr3 (229-348)||(8142646-8142765)
chr3 (254-309)||(15019302-15019357)
chr3 (281-316)||(27783061-27783096)
chr3 (229-280)||(33640079-33640130)
chr3 (296-357)||(34992797-34992860)
chr3 (249-334)||(2805342-2805428)
chr3 (235-309)||(8487518-8487591)
chr3 (231-272)||(1353490-1353531)
chr3 (283-312)||(1800039-1800068)
chr3 (231-264)||(21833398-21833431)
chr3 (229-290)||(26272323-26272384)
chr3 (229-262)||(27086693-27086726)
chr3 (235-288)||(32215520-32215573)
chr3 (318-346)||(20327564-20327592)
chr3 (229-309)||(21717348-21717428)
chr3 (244-347)||(35018678-35018779)
chr3 (229-309)||(42420829-42420909)
[»] scaffold0692 (2 HSPs)
scaffold0692 (229-346)||(5753-5870)
scaffold0692 (229-314)||(5543-5628)
[»] scaffold0092 (2 HSPs)
scaffold0092 (229-347)||(5622-5740)
scaffold0092 (229-357)||(5847-5975)
[»] scaffold0334 (1 HSPs)
scaffold0334 (232-357)||(4431-4556)
[»] scaffold0766 (2 HSPs)
scaffold0766 (228-348)||(6240-6360)
scaffold0766 (228-260)||(6393-6425)
[»] scaffold0005 (2 HSPs)
scaffold0005 (231-347)||(56426-56542)
scaffold0005 (228-343)||(288655-288770)
[»] scaffold0048 (2 HSPs)
scaffold0048 (229-347)||(81809-81927)
scaffold0048 (228-357)||(82032-82162)
[»] scaffold0481 (2 HSPs)
scaffold0481 (231-348)||(3472-3589)
scaffold0481 (231-358)||(3241-3366)
[»] scaffold0129 (2 HSPs)
scaffold0129 (229-337)||(14280-14388)
scaffold0129 (292-353)||(14499-14560)
[»] scaffold0050 (1 HSPs)
scaffold0050 (254-346)||(69557-69649)
[»] scaffold0400 (1 HSPs)
scaffold0400 (231-345)||(3813-3928)
[»] scaffold0365 (1 HSPs)
scaffold0365 (231-345)||(4457-4572)
[»] scaffold0027 (1 HSPs)
scaffold0027 (229-357)||(121509-121639)
[»] scaffold0083 (1 HSPs)
scaffold0083 (229-346)||(51205-51321)
[»] scaffold0181 (1 HSPs)
scaffold0181 (227-347)||(20906-21026)
[»] scaffold0060 (1 HSPs)
scaffold0060 (265-347)||(20542-20624)
[»] scaffold0047 (2 HSPs)
scaffold0047 (229-346)||(12615-12732)
scaffold0047 (227-357)||(12837-12973)
[»] scaffold0001 (1 HSPs)
scaffold0001 (289-346)||(429841-429898)
[»] scaffold0041 (2 HSPs)
scaffold0041 (229-309)||(67283-67363)
scaffold0041 (228-309)||(67490-67571)
[»] scaffold0024 (1 HSPs)
scaffold0024 (229-348)||(89552-89671)
[»] scaffold0729 (2 HSPs)
scaffold0729 (265-347)||(2476-2560)
scaffold0729 (298-357)||(2685-2745)
[»] scaffold0003 (1 HSPs)
scaffold0003 (228-307)||(347569-347648)
[»] scaffold1034 (1 HSPs)
scaffold1034 (286-347)||(3203-3264)
[»] scaffold0459 (1 HSPs)
scaffold0459 (277-353)||(13294-13370)
[»] scaffold0366 (2 HSPs)
scaffold0366 (277-353)||(10935-11011)
scaffold0366 (277-353)||(14601-14677)
[»] scaffold0045 (1 HSPs)
scaffold0045 (229-309)||(41205-41284)


Alignment Details
Target: chr2 (Bit Score: 170; Significance: 4e-91; HSPs: 99)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 170; E-Value: 4e-91
Query Start/End: Original strand, 43 - 228
Target Start/End: Complemental strand, 362091 - 361906
Alignment:
43 tatgacattttgaatgctacggttctgattgtatgcaattttgcagttatgtggtgataaagcttcagaagggatttttgttggtgctttcctttctatg 142  Q
    ||||||||||||||||||||| ||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||    
362091 tatgacattttgaatgctacgattctgattgtatgcaattttgcaattatgtggtggtaaagcttcagaagggatttttgttggtgctttcctttctatg 361992  T
143 tcttcaacagcagtggcatgagaatataagcaatctgcttctgttccattttaaagtgcatacactgtctaatgaacttccatgtc 228  Q
    ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
361991 tcttcaacagcagtggcatgagaatataagcaatctgcttctgtttcattttaaagtgcatacactgtctaatgaacttccatgtc 361906  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 99; E-Value: 9e-49
Query Start/End: Original strand, 228 - 357
Target Start/End: Complemental strand, 16419588 - 16419458
Alignment:
228 ctcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctat 327  Q
    ||||||||||| |||||||||||||||||||||||| ||||||||||| |||| ||||||||||||||||||||||||||||||||||  ||||||||||    
16419588 ctcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacacattgtcagaccatgtcctat 16419489  T
328 ccgatgtgggactcttaacac-ccccctcac 357  Q
    ||||||||||||||||||||| |||||||||    
16419488 ccgatgtgggactcttaacacaccccctcac 16419458  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 229 - 357
Target Start/End: Original strand, 5711674 - 5711802
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    ||||||||||||||||||||||||||||||||||| ||||||||||| | || ||| ||||||||||||||||||||||||||||||| |||||||| ||    
5711674 tcttagaaatggtggttgggcctaacacaaccccacaaaaccggcttttaaggtgatgattgcccccacttataaacacattgtcaggccatgtcctgtc 5711773  T
329 cgatgtgggactcttaacacccccctcac 357  Q
    |||||||||||||||||||| ||||||||    
5711774 cgatgtgggactcttaacacacccctcac 5711802  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 229 - 347
Target Start/End: Complemental strand, 2029854 - 2029736
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| |||||||||||||| ||||||||| ||||||||||| |||| ||||||||||| |||||||||||||||||||||||||||||||||||    
2029854 tcttagaaatcgtggttgggcctaaaacaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggtcatgtcctatc 2029755  T
329 cgatgtgggactcttaaca 347  Q
    |||||||||||||||||||    
2029754 cgatgtgggactcttaaca 2029736  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 91; E-Value: 5e-44
Query Start/End: Original strand, 229 - 347
Target Start/End: Original strand, 14466409 - 14466527
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    ||||||||||||||||||||||||||||||||||| ||||||||||| | || |||||||||| |||||||||||||||||||||||| |||||||| ||    
14466409 tcttagaaatggtggttgggcctaacacaaccccacaaaaccggcttgtaaggtgaggattgctcccacttataaacacattgtcaggccatgtcctgtc 14466508  T
329 cgatgtgggactcttaaca 347  Q
    |||||||||||||||||||    
14466509 cgatgtgggactcttaaca 14466527  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 229 - 357
Target Start/End: Complemental strand, 2030089 - 2029960
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| |||||||||||||| ||||||||| ||||||||||| |||| ||||||||||| |||||||||||||||||||||||||||||| | ||    
2030089 tcttagaaatcgtggttgggcctaaaacaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggtcatgtcatgtc 2029990  T
329 cgatgtgggactcttaacac-ccccctcac 357  Q
    |||||||||||||||||||| |||||||||    
2029989 cgatgtgggactcttaacacaccccctcac 2029960  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 229 - 357
Target Start/End: Original strand, 5711438 - 5711567
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| |||||||||||||||||||||||| ||||||||||| | || ||||||||||||||||||||||||||||||||||| ||| |||| ||    
5711438 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgttaggtgaggattgcccccacttataaacacattgtcaggccatttcctttc 5711537  T
329 cgatgtgggactcttaacac-ccccctcac 357  Q
    |||||||||||||||||||| |||||||||    
5711538 cgatgtgggactcttaacacaccccctcac 5711567  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 89; E-Value: 8e-43
Query Start/End: Original strand, 228 - 348
Target Start/End: Original strand, 40379207 - 40379327
Alignment:
228 ctcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctat 327  Q
    ||||||||||| |||||||||||||||||||||||| ||||||||||| |||| ||||||||||||||||||||||||||| ||||||| |||  |||||    
40379207 ctcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacacactgtcaggccatcacctat 40379306  T
328 ccgatgtgggactcttaacac 348  Q
    |||||||||||||||||||||    
40379307 ccgatgtgggactcttaacac 40379327  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 229 - 347
Target Start/End: Original strand, 40379443 - 40379561
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| |||||||||||||||||||||||| ||||||||||| |||| ||||||||||||||||||||||||||| ||||||| |||  ||||||    
40379443 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacacactgtcaggccatcacctatc 40379542  T
329 cgatgtgggactcttaaca 347  Q
    |||||||||||||||||||    
40379543 cgatgtgggactcttaaca 40379561  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 229 - 347
Target Start/End: Complemental strand, 17719485 - 17719367
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| ||||||||||| |||||||||| | ||||||||||| |||| ||||||||||||||||||||||||||||||||||| |||  ||||||    
17719485 tcttagaaattgtggttgggccgaacacaacccgacaaaaccggcttgtgaggtgaggattgcccccacttataaacacattgtcaggccatcacctatc 17719386  T
329 cgatgtgggactcttaaca 347  Q
    |||||||||||||||||||    
17719385 cgatgtgggactcttaaca 17719367  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 79; E-Value: 8e-37
Query Start/End: Original strand, 229 - 347
Target Start/End: Complemental strand, 37840422 - 37840304
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    ||||| |||| ||||||||||| |||||||||||| ||||||||||| |||| ||| ||||||| ||||||||||||||||||||||||||| |||||||    
37840422 tcttaaaaattgtggttgggcccaacacaaccccacaaaaccggcttgtgaggtgatgattgcctccacttataaacacattgtcaggtcatctcctatc 37840323  T
329 cgatgtgggactcttaaca 347  Q
    | |||||||||||||||||    
37840322 caatgtgggactcttaaca 37840304  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 229 - 347
Target Start/End: Original strand, 28407792 - 28407910
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| |||||||||||||||||||| ||| ||||||||||| |||| ||||||||||||||||||||||||| ||||| ||| ||  ||||| |    
28407792 tcttagaaatcgtggttgggcctaacacaactccacaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgttaggccaattcctaac 28407891  T
329 cgatgtgggactcttaaca 347  Q
    |||||||||||||||||||    
28407892 cgatgtgggactcttaaca 28407910  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 74; E-Value: 7e-34
Query Start/End: Original strand, 235 - 348
Target Start/End: Complemental strand, 2324319 - 2324206
Alignment:
235 aaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgt 334  Q
    |||| |||||||||||||||||||||||| ||||||||||| |||| ||||||||||||||||||||||||| ||||||||  ||  ||||| |||||||    
2324319 aaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcagaccaactcctaaccgatgt 2324220  T
335 gggactcttaacac 348  Q
    ||||||||||||||    
2324219 gggactcttaacac 2324206  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #14
Raw Score: 74; E-Value: 7e-34
Query Start/End: Original strand, 229 - 361
Target Start/End: Original strand, 15124547 - 15124680
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    ||||| |||| ||||||||| |||||||||||||| |||| |||||| |||| || |||||||||||||||||||||| ||||||||  ||||| |||||    
15124547 tcttaaaaatcgtggttgggtctaacacaaccccacaaaatcggcttatgaggtggggattgcccccacttataaacatattgtcagaccatgttctatc 15124646  T
329 cgatgtgggactcttaacac-ccccctcacaacc 361  Q
    ||||||||||||||||||||  ||||||||||||    
15124647 cgatgtgggactcttaacacatcccctcacaacc 15124680  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #15
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 243 - 347
Target Start/End: Complemental strand, 32884178 - 32884074
Alignment:
243 gttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggactct 342  Q
    ||||||||||||||||||||| ||||||||||| |||| ||||||||||||||||||||||||| ||||||||| ||  ||||| |||||||||||||||    
32884178 gttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcaggccaactcctaaccgatgtgggactct 32884079  T
343 taaca 347  Q
    |||||    
32884078 taaca 32884074  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #16
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 231 - 354
Target Start/End: Original strand, 17854693 - 17854816
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccg 330  Q
    |||||||| ||||||||||||||||||| |||| ||||||| ||| |||||||| ||||||||||||||||||||| |||||||||  |  ||||| |||    
17854693 ttagaaatcgtggttgggcctaacacaatcccacaaaaccgacttgtgagatgatgattgcccccacttataaacagattgtcaggctaactcctaaccg 17854792  T
331 atgtgggactcttaacacccccct 354  Q
    |||||||||||||||||| |||||    
17854793 atgtgggactcttaacacacccct 17854816  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #17
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 229 - 348
Target Start/End: Original strand, 27897605 - 27897723
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    ||||||||||||||||||||||||||||||||||| ||||||| ||| |||| |||| |||| ||||||||||||||| ||||||||| ||  ||||| |    
27897605 tcttagaaatggtggttgggcctaacacaaccccacaaaaccgacttgtgaggtgagaattg-ccccacttataaacaaattgtcaggccaactcctaac 27897703  T
329 cgatgtgggactcttaacac 348  Q
    ||||||||||||||||||||    
27897704 cgatgtgggactcttaacac 27897723  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #18
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 234 - 348
Target Start/End: Complemental strand, 2324554 - 2324440
Alignment:
234 gaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatg 333  Q
    ||||| ||||||| |||||||||||||||| ||||||||||| |||| ||||||||||||||||||||||||| ||||||||| ||  | ||| ||||||    
2324554 gaaatcgtggttgagcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcaggccaacttctaaccgatg 2324455  T
334 tgggactcttaacac 348  Q
    |||||||||||||||    
2324454 tgggactcttaacac 2324440  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #19
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 230 - 348
Target Start/End: Complemental strand, 29718412 - 29718294
Alignment:
230 cttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatcc 329  Q
    ||||||||| |||||| ||||||||||||||||| ||||||||||| |||| |||||||||||| |||||||||||| ||||||| | ||  ||||| ||    
29718412 cttagaaatcgtggttaggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgccctcacttataaacaaattgtcaagccaactcctaacc 29718313  T
330 gatgtgggactcttaacac 348  Q
    |||||||||||||||||||    
29718312 gatgtgggactcttaacac 29718294  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #20
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 231 - 348
Target Start/End: Original strand, 17854930 - 17855047
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccg 330  Q
    |||||||| ||||||||| ||| |||||||||| ||||||||||| |||| |||||||||||| |||||||||||| ||||||||||||  ||||| |||    
17854930 ttagaaatcgtggttgggtctagcacaaccccacaaaaccggcttgtgaggtgaggattgccctcacttataaacaaattgtcaggtcaactcctaaccg 17855029  T
331 atgtgggactcttaacac 348  Q
    ||||| ||||||||||||    
17855030 atgtgagactcttaacac 17855047  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #21
Raw Score: 69; E-Value: 7e-31
Query Start/End: Original strand, 231 - 347
Target Start/End: Original strand, 19191611 - 19191727
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccg 330  Q
    |||||||| |||||||||||||||||||||||| ||||||||||| |||| ||||||||| ||||||||||||||| | ||||||| ||  ||||| |||    
19191611 ttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgtccccacttataaacaaactgtcaggccaactcctaaccg 19191710  T
331 atgtgggactcttaaca 347  Q
    ||| |||||||||||||    
19191711 atgggggactcttaaca 19191727  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #22
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 240 - 347
Target Start/End: Original strand, 17525349 - 17525455
Alignment:
240 gtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggac 339  Q
    ||||||||||||| ||||| |||| ||||||||||| |||| ||||||||||||||||||||||||||||||||||  |||||| | |||||||||||||    
17525349 gtggttgggccta-cacaatcccacaaaaccggcttgtgaggtgaggattgcccccacttataaacacattgtcagaccatgtcatgtccgatgtgggac 17525447  T
340 tcttaaca 347  Q
    ||||||||    
17525448 tcttaaca 17525455  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #23
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 227 - 347
Target Start/End: Original strand, 5851678 - 5851802
Alignment:
227 tctcttagaaatggtggttgggcctaacacaacc-ccataaaaccggcttctgagatgaggattgcccccacttataaacacattgt---caggtcatgt 322  Q
    ||||||||||||| ||||||| |||||||||||| ||| ||||||||||| |||| ||||||||| ||||||||||||| |||||||   |||| |||||    
5851678 tctcttagaaatgatggttggacctaacacaacctccacaaaaccggcttgtgaggtgaggattgtccccacttataaatacattgtcagcaggccatgt 5851777  T
323 cctatccgatgtgggactcttaaca 347  Q
    ||| |||||||||||||||||||||    
5851778 cctgtccgatgtgggactcttaaca 5851802  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #24
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 229 - 343
Target Start/End: Complemental strand, 14927187 - 14927073
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| ||||||| ||||||||||||| || ||| | | ||| |||| ||||||||||||||||||||||||||||||||||||||| || ||||    
14927187 tcttagaaatcgtggttgagcctaacacaaccacacaaagctgacttatgaggtgaggattgcccccacttataaacacattgtcaggtcatctcttatc 14927088  T
329 cgatgtgggactctt 343  Q
    ||||||| |||||||    
14927087 cgatgtgtgactctt 14927073  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #25
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 228 - 361
Target Start/End: Original strand, 25082535 - 25082669
Alignment:
228 ctcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctat 327  Q
    ||||||||||| |||||||| ||||||||||||||| ||||| ||||| |||| ||| ||||||||| ||||||||||||||||||||  ||| || |||    
25082535 ctcttagaaatcgtggttggacctaacacaaccccacaaaactggcttgtgaggtgatgattgcccctacttataaacacattgtcagaccatctcttat 25082634  T
328 ccgatgtgggactcttaacac-ccccctcacaacc 361  Q
    | ||| || |||||||||||| |||||||||||||    
25082635 ctgatatgagactcttaacacaccccctcacaacc 25082669  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #26
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 231 - 348
Target Start/End: Original strand, 40149004 - 40149121
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccg 330  Q
    ||||||||  ||||||| ||||||||||||||| |||| |||||| |||| ||||||||| ||||||||||||||||| ||| ||||||| | |||||||    
40149004 ttagaaatcatggttggacctaacacaaccccacaaaatcggcttgtgaggtgaggattgtccccacttataaacacactgttaggtcatcttctatccg 40149103  T
331 atgtgggactcttaacac 348  Q
    ||||| ||||||||||||    
40149104 atgtgagactcttaacac 40149121  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #27
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 231 - 357
Target Start/End: Original strand, 27036416 - 27036539
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccg 330  Q
    ||||||||  ||||||||||||||||||||| | ||||||||||| ||||    |||||||||||||||||||||| ||||||||| ||  ||||| |||    
27036416 ttagaaatcatggttgggcctaacacaaccctacaaaaccggcttatgagg---ggattgcccccacttataaacaaattgtcaggccaactcctaaccg 27036512  T
331 atgtgggactcttaacacccccctcac 357  Q
    |||||||||||||||||| ||||||||    
27036513 atgtgggactcttaacacacccctcac 27036539  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #28
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 277 - 349
Target Start/End: Original strand, 37812545 - 37812617
Alignment:
277 tgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggactcttaacacc 349  Q
    |||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||    
37812545 tgaggtgaggattgcccccacttataaacacattgtcaggtcatgtcttatccgatgtgggactcttaacacc 37812617  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #29
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 228 - 347
Target Start/End: Original strand, 42639612 - 42639731
Alignment:
228 ctcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctat 327  Q
    |||||||| |||||||||||| |||||||||||||| |||||| |||| |||| ||| ||||| ||||| ||||||||||||||||||  |||||| |||    
42639612 ctcttagagatggtggttgggtctaacacaaccccacaaaaccagcttgtgaggtgacgattgtccccatttataaacacattgtcagaccatgtcatat 42639711  T
328 ccgatgtgggactcttaaca 347  Q
     | |||||||||||||||||    
42639712 tcaatgtgggactcttaaca 42639731  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #30
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 277 - 347
Target Start/End: Complemental strand, 4662268 - 4662198
Alignment:
277 tgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggactcttaaca 347  Q
    |||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
4662268 tgaggtgaggattgcccccacttataaacatattgtcaggtcatgtcctatccgatgtgggactcttaaca 4662198  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #31
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 230 - 347
Target Start/End: Complemental strand, 21591866 - 21591748
Alignment:
230 cttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattg-cccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    ||||||||| |||||||||||||||||||||||||||||||| ||| |||| ||| ||||| |||||||||||||||| ||||||||  ||  |||||      
21591866 cttagaaatcgtggttgggcctaacacaaccccataaaaccgacttatgaggtgaagattgccccccacttataaacaaattgtcagaccaactcctaat 21591767  T
329 cgatgtgggactcttaaca 347  Q
    |||||||||||||||||||    
21591766 cgatgtgggactcttaaca 21591748  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #32
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 231 - 348
Target Start/End: Original strand, 33606056 - 33606172
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccg 330  Q
    |||||||| ||||||||| |||||| ||  ||| |||||||| || |||| ||||||||||||| ||||||||||||||| ||||| ||| |||||||||    
33606056 ttagaaatcgtggttgggtctaaca-aattccacaaaaccggtttgtgaggtgaggattgcccctacttataaacacattttcaggccatctcctatccg 33606154  T
331 atgtgggactcttaacac 348  Q
    ||||||||||||||||||    
33606155 atgtgggactcttaacac 33606172  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #33
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 277 - 357
Target Start/End: Original strand, 37812315 - 37812396
Alignment:
277 tgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggactcttaacac-ccccctcac 357  Q
    |||| ||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||    
37812315 tgaggtgaggattgtccccacttataaacacattgtcaggccatgtcctatccgatgtgggactcttaacacaccccctcac 37812396  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #34
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 231 - 347
Target Start/End: Original strand, 12343751 - 12343867
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccg 330  Q
    |||||||  ||||||||| |||||||||||||| ||||| | ||| |||  |||||||||||||||||||||| ||||||||| |  ||| |||||||||    
12343751 ttagaaaccgtggttgggtctaacacaaccccacaaaactgacttatgatgtgaggattgcccccacttataagcacattgtctgaccatctcctatccg 12343850  T
331 atgtgggactcttaaca 347  Q
    |||||||||||||||||    
12343851 atgtgggactcttaaca 12343867  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #35
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 235 - 347
Target Start/End: Original strand, 37769948 - 37770060
Alignment:
235 aaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgt 334  Q
    |||| ||||||||| |||||||||||||| ||||||||||| |||| ||| ||||||||||||||||||||| |||||||   ||  ||||| |||||||    
37769948 aaatcgtggttgggtctaacacaaccccacaaaaccggcttatgaggtgaagattgcccccacttataaacaaattgtcaaaccaactcctaaccgatgt 37770047  T
335 gggactcttaaca 347  Q
    |||||||||||||    
37770048 gggactcttaaca 37770060  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #36
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 231 - 345
Target Start/End: Complemental strand, 5509162 - 5509048
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccg 330  Q
    ||||||||  ||||||||||||||||||||||| |||||| |||| |||| |||||||| |||||||||||||||| ||||||||  ||  ||||| |||    
5509162 ttagaaatcatggttgggcctaacacaaccccacaaaaccagcttgtgaggtgaggattacccccacttataaacaaattgtcagaccaactcctaaccg 5509063  T
331 atgtgggactcttaa 345  Q
    ||||| |||||||||    
5509062 atgtgtgactcttaa 5509048  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #37
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 250 - 348
Target Start/End: Complemental strand, 16533611 - 16533513
Alignment:
250 ctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggactcttaacac 348  Q
    ||||||||||| || ||||||||||| |||  ||||||||||||||||||||||||||||||||||| |||  |||||||| ||| |||||||||||||    
16533611 ctaacacaacctcacaaaaccggcttgtgaagtgaggattgcccccacttataaacacattgtcaggccatcacctatccggtgtaggactcttaacac 16533513  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #38
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 230 - 348
Target Start/End: Original strand, 17525099 - 17525217
Alignment:
230 cttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatcc 329  Q
    ||||||||| |||||||||||| ||||||  ||| ||||||||||| || | ||||||||   |||| |||||||||||||||||||||||||||| |||    
17525099 cttagaaattgtggttgggcctgacacaattccacaaaaccggcttgtgcggtgaggattcttcccatttataaacacattgtcaggtcatgtcctgtcc 17525198  T
330 gatgtgggactcttaacac 348  Q
    |||||| |||| |||||||    
17525199 gatgtgagacttttaacac 17525217  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #39
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 235 - 348
Target Start/End: Complemental strand, 5509392 - 5509279
Alignment:
235 aaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgt 334  Q
    |||| |||||||| |||||||| |||||| ||||||||||| || | ||||||||||||||||||||||||| |||||| || ||  ||||| | |||||    
5509392 aaatcgtggttggacctaacactaccccacaaaaccggcttgtggggtgaggattgcccccacttataaacaaattgtcgggccaactcctaactgatgt 5509293  T
335 gggactcttaacac 348  Q
    ||||||||||||||    
5509292 gggactcttaacac 5509279  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #40
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 230 - 347
Target Start/End: Complemental strand, 32356469 - 32356353
Alignment:
230 cttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatcc 329  Q
    ||||||| | || ||||||||||||||||| ||| ||||| ||||| || | ||||||||||||||||||||||||||||||||| ||||| || | |||    
32356469 cttagaattcgtagttgggcctaacacaactccacaaaactggcttgtggg-tgaggattgcccccacttataaacacattgtcatgtcatctcatgtcc 32356371  T
330 gatgtgggactcttaaca 347  Q
    |||||| |||||||||||    
32356370 gatgtgagactcttaaca 32356353  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #41
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 229 - 353
Target Start/End: Original strand, 36351924 - 36352049
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccg-gcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctat 327  Q
    |||||||||| |||||||||||||||| ||||||| ||||    |||| |||| |||| |||| ||||||||||||||||||||||||||| | ||||||    
36351924 tcttagaaatcgtggttgggcctaacataaccccacaaaaatttgcttgtgaggtgagaattgtccccacttataaacacattgtcaggtcgtctcctat 36352023  T
328 ccgatgtgggactcttaacacccccc 353  Q
    |||||||  |||||||||||| ||||    
36352024 ccgatgtaagactcttaacacacccc 36352049  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #42
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 229 - 348
Target Start/End: Original strand, 31700744 - 31700866
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgagg---attgcccccacttataaacacattgtcaggtcatgtcct 325  Q
    |||||||||| ||||||||||||||||||| |||| ||||||||||| |||| ||  |   ||||||| |||||||||||||||||||||| |||  |||    
31700744 tcttagaaatcgtggttgggcctaacacaaacccacaaaaccggcttgtgaggtggtgggaattgccctcacttataaacacattgtcaggccatcacct 31700843  T
326 atccgatgtgggactcttaacac 348  Q
    ||||||||||  |||||||||||    
31700844 atccgatgtgtaactcttaacac 31700866  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #43
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 235 - 347
Target Start/End: Original strand, 40718212 - 40718324
Alignment:
235 aaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgt 334  Q
    ||||| ||||||||||||||||||| ||| |||||||| || |||| ||| |||||||| |||||||||||| ||||| ||||||  ||||| |||||||    
40718212 aaatgatggttgggcctaacacaactccacaaaaccggtttgtgaggtgatgattgccctcacttataaacaaattgttaggtcaactcctaaccgatgt 40718311  T
335 gggactcttaaca 347  Q
    | |||||||||||    
40718312 gagactcttaaca 40718324  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #44
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 265 - 347
Target Start/End: Original strand, 94055 - 94137
Alignment:
265 aaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggactcttaaca 347  Q
    ||||||| ||| |||| ||||||||||||||||||||||||||| ||||||| |||  |||||||||||||||||||||||||    
94055 aaaaccgacttgtgaggtgaggattgcccccacttataaacacactgtcaggccatcacctatccgatgtgggactcttaaca 94137  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #45
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 229 - 347
Target Start/End: Original strand, 35418413 - 35418531
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| ||| |||  | |||| |||||||||||||||||||| |||| |||||||||||||||| |||||| | ||||| | ||||| |||||||    
35418413 tcttagaaattgtgattgaacttaacgcaaccccataaaaccggcttgtgaggtgaggattgcccccacctataaatatattgttatgtcatctcctatc 35418512  T
329 cgatgtgggactcttaaca 347  Q
    ||||||  |||||||||||    
35418513 cgatgtaagactcttaaca 35418531  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #46
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 229 - 353
Target Start/End: Original strand, 93121 - 93245
Alignment:
229 tcttagaaatggtggttggg-cctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctat 327  Q
    |||||||||| || |||||| |||||| || ||  | ||||||||||| | || |||||| |||||||||||||||||||||||||||| |||  |||||    
93121 tcttagaaatcgtagttggggcctaactcatccttacaaaaccggcttgtaaggtgaggagtgcccccacttataaacacattgtcagg-catcacctat 93219  T
328 ccgatgtgggactcttaacacccccc 353  Q
    ||||||||||||||||||||| ||||    
93220 ccgatgtgggactcttaacacacccc 93245  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #47
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 231 - 347
Target Start/End: Complemental strand, 13486417 - 13486300
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgccccc-acttataaacacattgtcaggtcatgtcctatcc 329  Q
    |||||||| |||||| ||||||||||||||||| |||| | | || |||| |||||||||||||| ||||||||| | ||||||||| ||  ||||| ||    
13486417 ttagaaatcgtggttaggcctaacacaaccccacaaaatcagtttgtgaggtgaggattgccccccacttataaataaattgtcaggccaactcctaacc 13486318  T
330 gatgtgggactcttaaca 347  Q
    ||||||||||||||||||    
13486317 gatgtgggactcttaaca 13486300  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #48
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 228 - 305
Target Start/End: Complemental strand, 17719652 - 17719575
Alignment:
228 ctcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaac 305  Q
    ||||||||||| |||||||||||||||||||||||| |||||||| || |||| | ||||||||||||||||||||||    
17719652 ctcttagaaatcgtggttgggcctaacacaaccccacaaaaccggtttgtgaggtcaggattgcccccacttataaac 17719575  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #49
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 231 - 348
Target Start/End: Original strand, 36316052 - 36316169
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccg 330  Q
    |||||||| |||||||| ||||||| ||||||| ||||| ||||| | |  ||||||||||||||||||||||||| ||||||||| ||  | ||| | |    
36316052 ttagaaatcgtggttggacctaacataaccccacaaaactggcttgtaatgtgaggattgcccccacttataaacaaattgtcaggccaacttctaactg 36316151  T
331 atgtgggactcttaacac 348  Q
    ||||||||||||||||||    
36316152 atgtgggactcttaacac 36316169  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #50
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 229 - 312
Target Start/End: Original strand, 36352158 - 36352241
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgt 312  Q
    ||||| |||| |||||||  ||||||||||||||| ||||||||||| |||| ||| |||||||||||||||||||||||||||    
36352158 tcttaaaaattgtggttgaacctaacacaaccccacaaaaccggcttttgaggtgatgattgcccccacttataaacacattgt 36352241  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #51
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 229 - 348
Target Start/End: Complemental strand, 9927996 - 9927875
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||| | |||||||| | ||||||||||||| |||| | |||| |||| |||||||| |||||||||||||||||||||||||  ||| | |||||    
9927996 tcttagaattcgtggttggacgtaacacaaccccaaaaaatcagcttgtgaggtgaggattacccccacttataaacacattgtcagaccatcttctatc 9927897  T
329 cg--atgtgggactcttaacac 348  Q
    ||  || |||||||||||||||    
9927896 cgatatttgggactcttaacac 9927875  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #52
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 228 - 309
Target Start/End: Original strand, 19570972 - 19571053
Alignment:
228 ctcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacat 309  Q
    ||||||||||| |||||||||||||||||||  ||| |||| || ||| |||| ||||||||||||||||||||||||||||    
19570972 ctcttagaaatcgtggttgggcctaacacaattccacaaaatcgacttatgaggtgaggattgcccccacttataaacacat 19571053  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #53
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 228 - 341
Target Start/End: Complemental strand, 24395949 - 24395837
Alignment:
228 ctcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctat 327  Q
    ||||||||||| |||||| ||||||||||||||||| |||| ||  || |||| ||||||||| ||||||| ||||||||||||| ||| |||  |||||    
24395949 ctcttagaaatcgtggtttggcctaacacaaccccacaaaatcgatttgtgaggtgaggattg-ccccactcataaacacattgttaggccatcacctat 24395851  T
328 ccgatgtgggactc 341  Q
    | ||||||||||||    
24395850 ctgatgtgggactc 24395837  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #54
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 229 - 320
Target Start/End: Original strand, 19544370 - 19544460
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcat 320  Q
    |||||||||| |||||||| ||||||| | | ||| ||||||||||| |||| |||| |||||||||||||||||||||||| |||||||||    
19544370 tcttagaaatcgtggttggacctaacatagctccacaaaaccggcttgtgaggtgag-attgcccccacttataaacacattatcaggtcat 19544460  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #55
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 265 - 347
Target Start/End: Complemental strand, 3738982 - 3738900
Alignment:
265 aaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggactcttaaca 347  Q
    |||||||| || |||  ||||||||||||||||||||||||||||| ||| ||||| | ||||||||||| ||||||||||||    
3738982 aaaaccggtttgtgatgtgaggattgcccccacttataaacacattatcatgtcatcttctatccgatgttggactcttaaca 3738900  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #56
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 229 - 310
Target Start/End: Original strand, 33606288 - 33606369
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacatt 310  Q
    |||||||||| ||||||| |||||||| ||| ||| ||||| ||||| |||| |||||||| ||||||||||||||||||||    
33606288 tcttagaaatcgtggttgtgcctaacataacgccacaaaactggcttgtgaggtgaggattacccccacttataaacacatt 33606369  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #57
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 231 - 347
Target Start/End: Complemental strand, 8424971 - 8424855
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccg 330  Q
    |||||||| ||||||| || ||||||||||||| ||||| || || |||| ||| ||||||||||||||||||| | ||||||||  ||  ||||| | |    
8424971 ttagaaatcgtggttgagcttaacacaaccccacaaaactggtttgtgaggtgatgattgcccccacttataaataaattgtcagaccaactcctaactg 8424872  T
331 atgtgggactcttaaca 347  Q
    |||||||||| ||||||    
8424871 atgtgggacttttaaca 8424855  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #58
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 290 - 357
Target Start/End: Original strand, 14466235 - 14466303
Alignment:
290 gcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggactcttaacac-ccccctcac 357  Q
    ||||||||||||||||||||||| ||| |||||||| |||||||||| ||||||||||| |||||||||    
14466235 gcccccacttataaacacattgttaggccatgtcctgtccgatgtggaactcttaacacaccccctcac 14466303  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #59
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 228 - 316
Target Start/End: Complemental strand, 14927379 - 14927291
Alignment:
228 ctcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcagg 316  Q
    ||||||||||  ||| ||||| |||| ||||| ||| |||| |||||| |||| ||||||||||||||||||||||||| |||||||||    
14927379 ctcttagaaactgtgattgggtctaatacaactccacaaaatcggcttatgaggtgaggattgcccccacttataaacatattgtcagg 14927291  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #60
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 251 - 343
Target Start/End: Complemental strand, 38629904 - 38629812
Alignment:
251 taacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggactctt 343  Q
    ||||||||  ||| ||||||| ||| |||||||||||||| ||| ||||||||| ||||||||| ||||| || ||||||||||| |||||||    
38629904 taacacaattccacaaaaccgacttgtgagatgaggattgtcccaacttataaatacattgtcatgtcatttcttatccgatgtgagactctt 38629812  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #61
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 229 - 347
Target Start/End: Original strand, 15124782 - 15124901
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcct-at 327  Q
    |||||||||| ||||||||| |||||||||||||| |||||||  || |||  ||| |||||||| |||||||||||||| |||||   |||||| | ||    
15124782 tcttagaaatcgtggttgggtctaacacaaccccacaaaaccgaattgtgaagtgaagattgccctcacttataaacacactgtcataccatgtcttaat 15124881  T
328 ccgatgtgggactcttaaca 347  Q
    | |||||| |||||||||||    
15124882 ctgatgtgagactcttaaca 15124901  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #62
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 229 - 303
Target Start/End: Complemental strand, 15988498 - 15988423
Alignment:
229 tcttagaaatggtggttgggcctaacacaacccc-ataaaaccggcttctgagatgaggattgcccccacttataa 303  Q
    |||||||||| ||||||||||| ||||||||||| | ||||| ||||| |||| ||||||||||||||||||||||    
15988498 tcttagaaatcgtggttgggcccaacacaacccccacaaaactggcttgtgaggtgaggattgcccccacttataa 15988423  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #63
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 281 - 347
Target Start/End: Original strand, 25313564 - 25313631
Alignment:
281 atgaggattgcccccacttataaa-cacattgtcaggtcatgtcctatccgatgtgggactcttaaca 347  Q
    |||| ||||||||||||||||||| |||||||||||||||| | |||||| |||||||||||||||||    
25313564 atgatgattgcccccacttataaaacacattgtcaggtcatctactatccaatgtgggactcttaaca 25313631  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #64
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 251 - 353
Target Start/End: Complemental strand, 24396163 - 24396061
Alignment:
251 taacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggactcttaacaccc 350  Q
    ||||||||||||| ||||||| ||| || | |||  ||| |||| ||||||||||| ||||||||| ||| |  |||||||||||||||||||||||| |    
24396163 taacacaaccccacaaaaccgacttgtggggtgataattacccctacttataaacatattgtcaggccatcttatatccgatgtgggactcttaacacac 24396064  T
351 ccc 353  Q
    |||    
24396063 ccc 24396061  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #65
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 231 - 288
Target Start/End: Original strand, 27897504 - 27897561
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggat 288  Q
    |||||||||||||||| ||||||||||||| |||||||||||||| |||| |||||||    
27897504 ttagaaatggtggttgagcctaacacaacctcataaaaccggcttgtgaggtgaggat 27897561  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #66
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 229 - 347
Target Start/End: Original strand, 40149235 - 40149343
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| |||||||||||||||||||        ||||| ||| |||| |||| |||||||| ||||||||||||||||| ||||||| || ||||    
40149235 tcttagaaattgtggttgggcctaacacaa--------aaccgacttgtgaggtgagaattgcccc-acttataaacacattgttaggtcatctcatatc 40149325  T
329 cgatgtgggactcttaaca 347  Q
    |||||| ||||||||||||    
40149326 cgatgt-ggactcttaaca 40149343  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #67
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 230 - 295
Target Start/End: Original strand, 21383284 - 21383351
Alignment:
230 cttagaaatggtggttgggcctaacacaaccc--cataaaaccggcttctgagatgaggattgccccc 295  Q
    ||||||||| ||||||||||||||||||||||  || ||||||||||| |||| ||||||||||||||    
21383284 cttagaaattgtggttgggcctaacacaaccccacaaaaaaccggcttgtgaggtgaggattgccccc 21383351  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #68
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 248 - 315
Target Start/End: Complemental strand, 15464835 - 15464768
Alignment:
248 gcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcag 315  Q
    |||||||||||||||| ||||| || || |||| ||||||||||||||||||| | ||||||||||||    
15464835 gcctaacacaaccccacaaaactggtttgtgaggtgaggattgcccccacttaaatacacattgtcag 15464768  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #69
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 265 - 348
Target Start/End: Original strand, 18607044 - 18607127
Alignment:
265 aaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggactcttaacac 348  Q
    ||||||||||| |||| ||| ||||| ||||||| ||||||||||||||||| |||  |||||| |||||| |||||| |||||    
18607044 aaaaccggcttttgaggtgatgattgtccccactaataaacacattgtcaggccatcacctatctgatgtgagactctaaacac 18607127  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #70
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 229 - 299
Target Start/End: Complemental strand, 10571055 - 10570985
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccactt 299  Q
    |||||||||| ||||||| |||||||||||||||| ||||||||||| | || ||| ||||||| ||||||    
10571055 tcttagaaatcgtggttgagcctaacacaaccccacaaaaccggcttgtaaggtgaagattgcctccactt 10570985  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #71
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 229 - 315
Target Start/End: Complemental strand, 11020643 - 11020557
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcag 315  Q
    |||||||||| | | |||| |||||||||| ||||  ||| |||||| |||| ||||||||||| ||||||||||||||||| ||||    
11020643 tcttagaaatcgcgattggacctaacacaatcccactaaatcggcttgtgaggtgaggattgcctccacttataaacacattttcag 11020557  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #72
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 229 - 287
Target Start/End: Complemental strand, 16419352 - 16419294
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgagga 287  Q
    |||||||||| |||||||||||||| ||||||||| ||||||||||| |||| ||||||    
16419352 tcttagaaatcgtggttgggcctaatacaaccccacaaaaccggcttgtgaggtgagga 16419294  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #73
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 231 - 320
Target Start/End: Complemental strand, 10523102 - 10523013
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcat 320  Q
    |||||||| ||||||||||||||||||| |||| ||||  |||||  ||| ||| ||||| | ||| |||||||||||||||||| ||||    
10523102 ttagaaatcgtggttgggcctaacacaatcccacaaaaatggcttgcgaggtgaagattgtcaccatttataaacacattgtcagatcat 10523013  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #74
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 229 - 306
Target Start/End: Complemental strand, 13210611 - 13210534
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaaca 306  Q
    |||||||| | ||||||||||||||||| |||||| ||||||| | | |||| |||||||||||| | ||||||||||    
13210611 tcttagaatttgtggttgggcctaacacgaccccacaaaaccgacctgtgaggtgaggattgccctctcttataaaca 13210534  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #75
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 231 - 343
Target Start/End: Complemental strand, 10523336 - 10523224
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccg 330  Q
    |||||||  ||||||||| ||||  |||||||| |||||  |||| |||| |||||| ||  || ||||| ||||||||||||||  ||| || ||||||    
10523336 ttagaaacagtggttgggtctaatgcaaccccacaaaactagcttgtgaggtgaggaatgttcctacttaaaaacacattgtcagaccatctcttatccg 10523237  T
331 atgtgggactctt 343  Q
    |||||||||||||    
10523236 atgtgggactctt 10523224  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #76
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 284 - 348
Target Start/End: Complemental strand, 15518790 - 15518726
Alignment:
284 aggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggactcttaacac 348  Q
    |||||||||| ||||||||||||||||||||||   |  ||||||| ||||||||||||||||||    
15518790 aggattgccctcacttataaacacattgtcaggctgtcacctatccaatgtgggactcttaacac 15518726  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #77
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 229 - 309
Target Start/End: Original strand, 30006578 - 30006658
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacat 309  Q
    |||||||||| |||||||||||  |||||||| || ||||||||||| || | ||| ||||  ||||||||||||||||||    
30006578 tcttagaaatcgtggttgggccgtacacaacctcacaaaaccggcttgtgtggtgatgattatccccacttataaacacat 30006658  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #78
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 229 - 309
Target Start/End: Original strand, 30063266 - 30063346
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacat 309  Q
    |||||||||| |||||||||||  |||||||| || ||||||||||| || | ||| ||||  ||||||||||||||||||    
30063266 tcttagaaatcgtggttgggccatacacaacctcacaaaaccggcttgtgtggtgatgattatccccacttataaacacat 30063346  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #79
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 231 - 303
Target Start/End: Original strand, 31008572 - 31008644
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataa 303  Q
    |||||||  ||||||| |||||||||||||||| ||||||||| | |||| |||| ||||||| |||||||||    
31008572 ttagaaactgtggttgagcctaacacaaccccacaaaaccggcatgtgaggtgagaattgcccacacttataa 31008644  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #80
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 229 - 307
Target Start/End: Complemental strand, 8227434 - 8227356
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacac 307  Q
    |||||||| | ||||||||| |||||| ||||| | ||||||| ||  | || ||||||||||||||||||||||||||    
8227434 tcttagaatttgtggttgggactaacataaccctacaaaaccgcctcgtaaggtgaggattgcccccacttataaacac 8227356  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #81
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 229 - 270
Target Start/End: Original strand, 93626 - 93667
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaacc 270  Q
    |||||||||| |||||||||||||||||||||||| ||||||    
93626 tcttagaaatcgtggttgggcctaacacaaccccacaaaacc 93667  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #82
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 231 - 312
Target Start/End: Complemental strand, 5594323 - 5594242
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgt 312  Q
    |||||||| ||||||| || ||||||||| ||||||||||||||| | || |||| |||||  ||| |||||| ||||||||    
5594323 ttagaaatcgtggttgagcttaacacaactccataaaaccggcttataaggtgagaattgcttccatttataagcacattgt 5594242  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #83
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 231 - 304
Target Start/End: Complemental strand, 31222604 - 31222531
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaa 304  Q
    |||||||| |||||||| ||||||||||||| | |||| ||| || || | ||||||||||| |||||||||||    
31222604 ttagaaatcgtggttggtcctaacacaaccctacaaaatcggtttatggggtgaggattgcctccacttataaa 31222531  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #84
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 247 - 303
Target Start/End: Original strand, 93737 - 93793
Alignment:
247 ggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataa 303  Q
    |||||||| || || || ||||||||||| |||| ||||||||||||||||||||||    
93737 ggcctaactcatcctcacaaaaccggcttgtgaggtgaggattgcccccacttataa 93793  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #85
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 343
Target Start/End: Original strand, 11099656 - 11099716
Alignment:
283 gaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggactctt 343  Q
    ||||| ||| || ||||||||||||||||||||||||| || |||| |||||| |||||||    
11099656 gaggactgcaccaacttataaacacattgtcaggtcatctcttatctgatgtgagactctt 11099716  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #86
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 277 - 348
Target Start/End: Original strand, 24666279 - 24666351
Alignment:
277 tgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctat-ccgatgtgggactcttaacac 348  Q
    |||| ||||||||||||| ||| ||||||||||| |||||||||  ||||| |||||| |||||||| |||||    
24666279 tgaggtgaggattgccccaactaataaacacattttcaggtcatcacctatcccgatgcgggactctgaacac 24666351  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #87
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 7 - 42
Target Start/End: Complemental strand, 362191 - 362156
Alignment:
7 ataatataatttgagtgtttggtgtatttcagtttt 42  Q
    |||||||||||| |||||||||||||||||||||||    
362191 ataatataattttagtgtttggtgtatttcagtttt 362156  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #88
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 227 - 298
Target Start/End: Original strand, 5450487 - 5450558
Alignment:
227 tctcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccact 298  Q
    |||| ||||| | |||||||||||||| ||||||||| ||||||||||| |||| ||| |  ||||||||||    
5450487 tctcctagaatttgtggttgggcctaagacaaccccacaaaaccggcttgtgaggtgatggctgcccccact 5450558  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #89
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 268 - 343
Target Start/End: Original strand, 44404196 - 44404271
Alignment:
268 accggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggactctt 343  Q
    |||||||| |||| ||| ||||||||||||||| ||||| ||||||||  |||  |||||||||||| ||| ||||    
44404196 accggcttgtgaggtgatgattgcccccacttacaaacatattgtcagaccatcacctatccgatgtaggattctt 44404271  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #90
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 265 - 303
Target Start/End: Original strand, 93482 - 93520
Alignment:
265 aaaaccggcttctgagatgaggattgcccccacttataa 303  Q
    ||||||||||| |||| ||||||||||||||||||||||    
93482 aaaaccggcttgtgaggtgaggattgcccccacttataa 93520  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #91
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 235 - 313
Target Start/End: Original strand, 1926446 - 1926524
Alignment:
235 aaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtc 313  Q
    |||| ||||||| ||||||||||| || | |||||||  || |||| |||||||| |||||||||||||| | ||||||    
1926446 aaatcgtggttgagcctaacacaatcctacaaaaccgatttgtgaggtgaggattacccccacttataaataaattgtc 1926524  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #92
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 293 - 347
Target Start/End: Original strand, 19544313 - 19544367
Alignment:
293 cccacttataaacacattgtcaggtcatgtcctatccgatgtgggactcttaaca 347  Q
    ||||||||||||| |||||||||||||| || ||| | ||||| |||||||||||    
19544313 cccacttataaacgcattgtcaggtcatctcatattcaatgtgagactcttaaca 19544367  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #93
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 229 - 270
Target Start/End: Original strand, 93353 - 93394
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaacc 270  Q
    ||||| |||| |||||||||||||||||||||||| ||||||    
93353 tcttaaaaatcgtggttgggcctaacacaaccccacaaaacc 93394  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #94
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 282 - 311
Target Start/End: Complemental strand, 4431686 - 4431657
Alignment:
282 tgaggattgcccccacttataaacacattg 311  Q
    ||||||||||||||||||||||||||||||    
4431686 tgaggattgcccccacttataaacacattg 4431657  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #95
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 240 - 305
Target Start/End: Original strand, 9952094 - 9952158
Alignment:
240 gtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaac 305  Q
    |||||||| |||||| ||| |||| |||||||| || |||||| ||||||| ||||||||||||||    
9952094 gtggttggacctaacgcaatcccacaaaaccggattgtgagataaggattg-ccccacttataaac 9952158  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #96
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 265 - 309
Target Start/End: Complemental strand, 15988262 - 15988218
Alignment:
265 aaaaccggcttctgagatgaggattgcccccacttataaacacat 309  Q
    ||||||||||| |||| |||||||| |||||||||||||| ||||    
15988262 aaaaccggcttgtgaggtgaggatttcccccacttataaaaacat 15988218  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #97
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 231 - 271
Target Start/End: Original strand, 30701126 - 30701166
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccg 271  Q
    |||||||| |||||||||| ||||||||||||| |||||||    
30701126 ttagaaattgtggttgggcttaacacaaccccacaaaaccg 30701166  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #98
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 320 - 348
Target Start/End: Original strand, 38021001 - 38021029
Alignment:
320 tgtcctatccgatgtgggactcttaacac 348  Q
    |||||||||||||||||||||||||||||    
38021001 tgtcctatccgatgtgggactcttaacac 38021029  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #99
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 277 - 353
Target Start/End: Original strand, 44403973 - 44404049
Alignment:
277 tgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggactcttaacacccccc 353  Q
    |||| |||||||||| | |||||| |||||||||||||||  ||  ||||| ||||||  |||||||||||| ||||    
44403973 tgaggtgaggattgcactcacttacaaacacattgtcaggctatcacctattcgatgtatgactcttaacacacccc 44404049  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 160; Significance: 3e-85; HSPs: 119)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 160; E-Value: 3e-85
Query Start/End: Original strand, 43 - 226
Target Start/End: Original strand, 4383028 - 4383211
Alignment:
43 tatgacattttgaatgctacggttctgattgtatgcaattttgcagttatgtggtgataaagcttcagaagggatttttgttggtgctttcctttctatg 142  Q
    |||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
4383028 tatgacattttgaatgctacagttctgattgtatgcaattttgcagttatgtggtggtaaagcttcagaagggatttttgttggtgctttcctttctatg 4383127  T
143 tcttcaacagcagtggcatgagaatataagcaatctgcttctgttccattttaaagtgcatacactgtctaatgaacttccatg 226  Q
    |||||||||||||||| |||| ||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||    
4383128 tcttcaacagcagtggtatgataatataagcaatctgattctgttccattttaaagtgcacacactgtctaatgaacttccatg 4383211  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 229 - 361
Target Start/End: Complemental strand, 35772349 - 35772216
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| |||||||||||||||||||||||| |||||||||||||||| | ||||||||||||||||||||||||||||||||| ||| |||||||    
35772349 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttctgaggtaaggattgcccccacttataaacacattgtcaggccatctcctatc 35772250  T
329 cgatgtgggactcttaacac-ccccctcacaacc 361  Q
    |||||||||||||||||||| ||| |||||||||    
35772249 cgatgtgggactcttaacacacccgctcacaacc 35772216  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 91; E-Value: 5e-44
Query Start/End: Original strand, 229 - 347
Target Start/End: Original strand, 4113005 - 4113123
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| |||||||||||||||||||||||| ||||||||||| |||| ||||||||||||||||||||||||||||||||||| ||||||| |||    
4113005 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacacattgtcaggccatgtcccatc 4113104  T
329 cgatgtgggactcttaaca 347  Q
    |||||||||||| ||||||    
4113105 cgatgtgggacttttaaca 4113123  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 229 - 342
Target Start/End: Complemental strand, 40079237 - 40079124
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| |||||||||||||||||||||||| ||||||||||| |||| ||||||||||||||||||||||||||||||||||||||| |||||||    
40079237 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacacattgtcaggtcatctcctatc 40079138  T
329 cgatgtgggactct 342  Q
    |||||| |||||||    
40079137 cgatgtaggactct 40079124  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 89; E-Value: 8e-43
Query Start/End: Original strand, 229 - 353
Target Start/End: Complemental strand, 26177228 - 26177104
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| |||||||||||||||||||||||| ||||| || || |||| |||||||||||||||||||||||||| ||||||||||||||||| ||    
26177228 tcttagaaatcgtggttgggcctaacacaaccccacaaaactggtttttgaggtgaggattgcccccacttataaacacgttgtcaggtcatgtcctgtc 26177129  T
329 cgatgtgggactcttaacacccccc 353  Q
    |||||||||||||||||||| ||||    
26177128 cgatgtgggactcttaacacacccc 26177104  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 86; E-Value: 5e-41
Query Start/End: Original strand, 228 - 353
Target Start/End: Original strand, 2859390 - 2859515
Alignment:
228 ctcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctat 327  Q
    ||||||||||||||||||||||||||||||||| || | ||||||||| |||| | ||||||||||||||||||||||||||||||||| |||  |||||    
2859390 ctcttagaaatggtggttgggcctaacacaacctcacagaaccggcttgtgaggtaaggattgcccccacttataaacacattgtcaggccatcacctat 2859489  T
328 ccgatgtgggactcttaacacccccc 353  Q
    ||||||||||||||||| ||||||||    
2859490 ccgatgtgggactcttatcacccccc 2859515  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 229 - 347
Target Start/End: Original strand, 17452827 - 17452945
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| |||||| ||||||||||||||||| ||||||||||| |||| ||| ||||||||||||||||||| ||||||||||| |||||| ||||    
17452827 tcttagaaatcgtggttaggcctaacacaaccccacaaaaccggcttgtgaggtgaagattgcccccacttataaatacattgtcaggccatgtcttatc 17452926  T
329 cgatgtgggactcttaaca 347  Q
    |||||||||||||||||||    
17452927 cgatgtgggactcttaaca 17452945  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 81; E-Value: 5e-38
Query Start/End: Original strand, 229 - 353
Target Start/End: Original strand, 4112539 - 4112663
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| ||||||| ||||||||||| ||||||||| |||||| |||| ||| ||||||||| ||||||||||||||||||| | |||||||| ||    
4112539 tcttagaaatcgtggttgtgcctaacacaatcccataaaatcggcttgtgaggtgatgattgcccctacttataaacacattgtcatgccatgtcctgtc 4112638  T
329 cgatgtgggactcttaacacccccc 353  Q
    |||||||||||||||||||||||||    
4112639 cgatgtgggactcttaacacccccc 4112663  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 81; E-Value: 5e-38
Query Start/End: Original strand, 227 - 347
Target Start/End: Original strand, 15986330 - 15986450
Alignment:
227 tctcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtccta 326  Q
    ||||||||||||||||||||| ||||||||||||||| || ||| |||| |||| |||||||||||||||||||||||||||||||||||  || |||||    
15986330 tctcttagaaatggtggttggacctaacacaaccccacaataccagcttgtgaggtgaggattgcccccacttataaacacattgtcaggctatctccta 15986429  T
327 tccgatgtgggactcttaaca 347  Q
    |||||||| ||||||||||||    
15986430 tccgatgtaggactcttaaca 15986450  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 81; E-Value: 5e-38
Query Start/End: Original strand, 229 - 353
Target Start/End: Complemental strand, 25713478 - 25713354
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    ||||||||||||||||| ||||||||||||| ||| ||||| ||||| |||| ||| ||||||||||||||||||||||||||||||  |||  ||||||    
25713478 tcttagaaatggtggttaggcctaacacaactccacaaaactggcttgtgaggtgacgattgcccccacttataaacacattgtcagaccatcacctatc 25713379  T
329 cgatgtgggactcttaacacccccc 353  Q
    |||||||||||||||||||||||||    
25713378 cgatgtgggactcttaacacccccc 25713354  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 228 - 347
Target Start/End: Original strand, 52650769 - 52650888
Alignment:
228 ctcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctat 327  Q
    |||||||||||  ||||||||||||||||||||||| |||||| |||| |||| |||||||||||||||||||||||||||||||| || ||| ||||||    
52650769 ctcttagaaattatggttgggcctaacacaaccccacaaaaccagcttgtgaggtgaggattgcccccacttataaacacattgtccggccatctcctat 52650868  T
328 ccgatgtgggactcttaaca 347  Q
    |||||||||||||| |||||    
52650869 ccgatgtgggactcctaaca 52650888  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 79; E-Value: 8e-37
Query Start/End: Original strand, 229 - 347
Target Start/End: Original strand, 20208527 - 20208643
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| |||||||||||||||||||||||| ||| ||||||  |||| ||||||||||||||||||||||||||||||||||  |||||||||||    
20208527 tcttagaaatcgtggttgggcctaacacaaccccacaaa-ccggcta-tgaggtgaggattgcccccacttataaacacattgtcagaccatgtcctatc 20208624  T
329 cgatgtgggactcttaaca 347  Q
    |||||||||||||||||||    
20208625 cgatgtgggactcttaaca 20208643  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 79; E-Value: 8e-37
Query Start/End: Original strand, 229 - 347
Target Start/End: Complemental strand, 26176993 - 26176875
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| | |||||||||||||||||||||| |||||||| || |||| |||||||||||| ||||||||| |||||||||||| |||||||| ||    
26176993 tcttagaaatcgcggttgggcctaacacaaccccacaaaaccggtttttgaggtgaggattgccctcacttataagcacattgtcaggccatgtcctgtc 26176894  T
329 cgatgtgggactcttaaca 347  Q
    |||||||||||||||||||    
26176893 cgatgtgggactcttaaca 26176875  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 79; E-Value: 8e-37
Query Start/End: Original strand, 232 - 357
Target Start/End: Complemental strand, 52961664 - 52961538
Alignment:
232 tagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccga 331  Q
    |||||||  ||||||| ||||||||||||||||||||||||||| |||| |||||||||||| |||||||||||||||||||||  ||| ||||||||||    
52961664 tagaaatcatggttggacctaacacaaccccataaaaccggcttttgaggtgaggattgccctcacttataaacacattgtcagaccatctcctatccga 52961565  T
332 tgtgggactcttaacac-ccccctcac 357  Q
    |||||||| |||||||| |||||||||    
52961564 tgtgggacacttaacacaccccctcac 52961538  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #15
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 231 - 340
Target Start/End: Original strand, 17452680 - 17452789
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccg 330  Q
    |||||||| |||||||||||||||||||||||| ||||||||||| |||| ||||||||||||||||||||||| ||||||||||| |||||| |||| |    
17452680 ttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaatacattgtcaggccatgtcttatctg 17452779  T
331 atgtgggact 340  Q
    ||||||||||    
17452780 atgtgggact 17452789  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #16
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 229 - 349
Target Start/End: Original strand, 25145719 - 25145839
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    ||||||||||  ||||||||||||||||||||||| ||| ||||||| |||| ||||||||||||||||| ||||| |||||||||||||||  ||||||    
25145719 tcttagaaatcatggttgggcctaacacaaccccacaaatccggcttgtgaggtgaggattgcccccactaataaatacattgtcaggtcatcacctatc 25145818  T
329 cgatgtgggactcttaacacc 349  Q
    ||||||| |||||||||||||    
25145819 cgatgtgagactcttaacacc 25145839  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #17
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 231 - 347
Target Start/End: Complemental strand, 51589075 - 51588959
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccg 330  Q
    ||||||||||||||||||||||||||||||||| ||||||||||| |||| |||||||||||| |||||||||||| ||||||||  ||  ||||| |||    
51589075 ttagaaatggtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgccctcacttataaacaaattgtcagaccaactcctaaccg 51588976  T
331 atgtgggactcttaaca 347  Q
    |||||||||||||||||    
51588975 atgtgggactcttaaca 51588959  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #18
Raw Score: 76; E-Value: 5e-35
Query Start/End: Original strand, 228 - 347
Target Start/End: Original strand, 26865356 - 26865475
Alignment:
228 ctcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctat 327  Q
    ||||||||||| ||||||| |||||| ||||||||| ||||||||||| |||| || |||||||||||||||||||| |||||||||||||||||| | |    
26865356 ctcttagaaattgtggttgagcctaatacaaccccacaaaaccggcttgtgaggtggggattgcccccacttataaatacattgtcaggtcatgtcttgt 26865455  T
328 ccgatgtgggactcttaaca 347  Q
    |||||||||||| |||||||    
26865456 ccgatgtgggacacttaaca 26865475  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #19
Raw Score: 74; E-Value: 7e-34
Query Start/End: Original strand, 231 - 348
Target Start/End: Complemental strand, 3169849 - 3169732
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccg 330  Q
    |||||||| |||||||||||||||||||||||| ||||||||||| |||| ||| ||||||||||||||||||||| ||||||||  ||  ||||| |||    
3169849 ttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaagattgcccccacttataaacaaattgtcagaccaactcctaaccg 3169750  T
331 atgtgggactcttaacac 348  Q
    ||||||||||||||||||    
3169749 atgtgggactcttaacac 3169732  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #20
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 227 - 347
Target Start/End: Original strand, 41035824 - 41035944
Alignment:
227 tctcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtccta 326  Q
    |||||||||||| || ||||| |||||||||| |||| ||||||||||| |||| ||||||||||||||||||||||||| |||| |||| |||||||||    
41035824 tctcttagaaatcgtagttggacctaacacaatcccacaaaaccggcttgtgaggtgaggattgcccccacttataaacatattggcaggccatgtccta 41035923  T
327 tccgatgtgggactcttaaca 347  Q
    ||||| ||| |||||||||||    
41035924 tccgacgtgagactcttaaca 41035944  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #21
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 231 - 346
Target Start/End: Original strand, 25137304 - 25137419
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccg 330  Q
    |||||||| |||||||||||||||||||||||| ||||||||||| |||| ||||||||||||  ||||||||||| ||||||||| ||  ||||| |||    
25137304 ttagaaattgtggttgggcctaacacaaccccacaaaaccggcttatgaggtgaggattgcccatacttataaacaaattgtcaggccaactcctaaccg 25137403  T
331 atgtgggactcttaac 346  Q
    ||||||||||||||||    
25137404 atgtgggactcttaac 25137419  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #22
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 229 - 351
Target Start/End: Original strand, 39348118 - 39348240
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| ||||||||| |||||||||||||| | ||||||||  | || ||||||||||| |||||||||||||||||||||||  || |||||||    
39348118 tcttagaaatcgtggttgggtctaacacaaccccacagaaccggctggtaagttgaggattgcctccacttataaacacattgtcaggctatctcctatc 39348217  T
329 cgatgtgggactcttaacacccc 351  Q
    ||||||||||||||| |||||||    
39348218 cgatgtgggactcttcacacccc 39348240  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #23
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 231 - 353
Target Start/End: Complemental strand, 51589309 - 51589187
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccg 330  Q
    |||||||| |||||| ||||||||||||||||| ||||||||||| |||| |||||||||||| |||||||||||| ||||||||  ||  ||||| |||    
51589309 ttagaaatcgtggttaggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgccctcacttataaacaaattgtcagaccaactcctaaccg 51589210  T
331 atgtgggactcttaacacccccc 353  Q
    |||||||||||||||||| ||||    
51589209 atgtgggactcttaacacacccc 51589187  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #24
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 229 - 357
Target Start/End: Original strand, 25145484 - 25145613
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| ||||||||| ||||||||||| || ||||||| ||| |||| ||||||||||||||||| ||||||||||||||||  |||  ||||||    
25145484 tcttagaaatcgtggttgggtctaacacaacctcacaaaaccgacttgtgaggtgaggattgcccccactaataaacacattgtcagaccatcacctatc 25145583  T
329 cgatgtgggactcttaacac-ccccctcac 357  Q
    ||||||| |||||||||||| |||||||||    
25145584 cgatgtgagactcttaacacaccccctcac 25145613  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #25
Raw Score: 69; E-Value: 7e-31
Query Start/End: Original strand, 235 - 347
Target Start/End: Complemental strand, 38080683 - 38080572
Alignment:
235 aaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgt 334  Q
    |||| |||||||||||||||||||||||| ||||| ||||| |||| ||||||||||||| | ||||||||||||||||||| ||| ||| |||||||||    
38080683 aaattgtggttgggcctaacacaaccccacaaaactggcttgtgaggtgaggattgccccaa-ttataaacacattgtcaggccatctcccatccgatgt 38080585  T
335 gggactcttaaca 347  Q
    |||||||||||||    
38080584 gggactcttaaca 38080572  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #26
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 229 - 347
Target Start/End: Original strand, 8870909 - 8871032
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcag-----gtcatgtc 323  Q
    ||||||||||||||||||| ||||||||||||||| |||| |||||| |||| |||| |||||||| ||||||||||||||||||||     ||||||||    
8870909 tcttagaaatggtggttggacctaacacaaccccacaaaaacggcttatgaggtgagaattgccccaacttataaacacattgtcagatcatgtcatgtc 8871008  T
324 ctatccgatgtgggactcttaaca 347  Q
     | |||||||||||||||||||||    
8871009 atgtccgatgtgggactcttaaca 8871032  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #27
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 228 - 348
Target Start/End: Complemental strand, 16163255 - 16163133
Alignment:
228 ctcttagaaatggtggttgggcctaacaca--accccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcct 325  Q
    |||||| |||| |||||||||||||||| |  |||||| |||||||| || |||| ||| ||||||||||||||||||||||||||||| |||||  |||    
16163255 ctcttaaaaattgtggttgggcctaacatataaccccacaaaaccggattgtgaggtgaagattgcccccacttataaacacattgtcaagtcatcacct 16163156  T
326 atccgatgtgggactcttaacac 348  Q
    |||||||||||||||||||||||    
16163155 atccgatgtgggactcttaacac 16163133  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #28
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 229 - 347
Target Start/End: Original strand, 2859626 - 2859744
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    ||||||||||| |||||||| ||||||||||| || ||||||||||| |||| |||||||| |||||||| ||||||||||||||||  |||  ||||||    
2859626 tcttagaaatgatggttggggctaacacaacctcacaaaaccggcttgtgaggtgaggattacccccactaataaacacattgtcagaccatcacctatc 2859725  T
329 cgatgtgggactcttaaca 347  Q
    ||||||| |||||||||||    
2859726 cgatgtgagactcttaaca 2859744  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #29
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 229 - 343
Target Start/End: Original strand, 31181512 - 31181626
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||| | ||||||||||||||||||||||||||||||| |||| |||| ||||||||||||||||||||||||||||  ||||| ||| || ||||    
31181512 tcttagaatttgtggttgggcctaacacaaccccataaaaccagcttgtgaggtgaggattgcccccacttataaacacatgttcaggccatctcttatc 31181611  T
329 cgatgtgggactctt 343  Q
    | |||||| ||||||    
31181612 caatgtggaactctt 31181626  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #30
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 229 - 347
Target Start/End: Original strand, 42586438 - 42586555
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| |||||||||||||||||||||||| ||||  ||||| |||| ||||||||| ||||||||||| ||||||||||||| ||| || ||||    
42586438 tcttagaaatcgtggttgggcctaacacaaccccacaaaattggcttgtgaggtgaggattg-ccccacttatatacacattgtcaggccatctcttatc 42586536  T
329 cgatgtgggactcttaaca 347  Q
    ||||||| |||||||||||    
42586537 cgatgtgagactcttaaca 42586555  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #31
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 229 - 357
Target Start/End: Original strand, 51459704 - 51459833
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| |||||||||||||| |||| |||| |||||| |||| | ||||| |||||||||||||||||||||||||||| |||  ||  ||||||    
51459704 tcttagaaattgtggttgggcctaatacaatcccacaaaaccagcttgtaagatgcggattgcccccacttataaacacattgttaggctatcacctatc 51459803  T
329 cgatgtgggactcttaacac-ccccctcac 357  Q
    |||| ||||||||||||||| |||||||||    
51459804 cgatatgggactcttaacacaccccctcac 51459833  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #32
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 231 - 347
Target Start/End: Original strand, 26173457 - 26173573
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccg 330  Q
    ||||||| ||||||||| ||||||||||||||| |||||||||||   || |||| |||||||||||||||||||||||||||||  ||| || |||| |    
26173457 ttagaaagggtggttggacctaacacaaccccacaaaaccggcttacaaggtgagaattgcccccacttataaacacattgtcagaccatctcatatctg 26173556  T
331 atgtgggactcttaaca 347  Q
    |||||||||||||||||    
26173557 atgtgggactcttaaca 26173573  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #33
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 229 - 348
Target Start/End: Complemental strand, 856066 - 855947
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||  || |||||||||||||||| | || |||||| |||| |||| ||||||||| |||||| |||||||||||||||||| |||||||||||    
856066 tcttagaaaacgtagttgggcctaacacaatctcacaaaaccagcttgtgaggtgaggattgtccccacgtataaacacattgtcaggccatgtcctatc 855967  T
329 cgatgtgggactcttaacac 348  Q
    || ||||| |||||||||||    
855966 cggtgtggaactcttaacac 855947  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #34
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 229 - 348
Target Start/End: Complemental strand, 38733467 - 38733348
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| || |||||||||||||||||| || ||||||||| | |||| |||||||||||| |||||||||||| ||||||||  |||  | ||||    
38733467 tcttagaaatcgttgttgggcctaacacaacctcacaaaaccggcctatgaggtgaggattgccctcacttataaacatattgtcagaccatcacatatc 38733368  T
329 cgatgtgggactcttaacac 348  Q
    ||||||||||||||||||||    
38733367 cgatgtgggactcttaacac 38733348  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #35
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 228 - 348
Target Start/End: Complemental strand, 27413668 - 27413548
Alignment:
228 ctcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctat 327  Q
    |||||||||||  |||||| ||||||||||||| ||||||||||  || |||| ||||||||||| ||||||||||||| ||||||||| |||  |||||    
27413668 ctcttagaaatcatggttgagcctaacacaacctcataaaaccgatttgtgaggtgaggattgcctccacttataaacatattgtcaggccatcacctat 27413569  T
328 ccgatgtgggactcttaacac 348  Q
     |||||||||||| |||||||    
27413568 gcgatgtgggacttttaacac 27413548  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #36
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 229 - 347
Target Start/End: Complemental strand, 35772114 - 35772002
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| |||||||||||||||||||||||| |||||||||||  ||| |||||||||||| |||||      ||||||||||||||| |||||||    
35772114 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgcgaggtgaggattgcccacactt------acattgtcaggtcatctcctatc 35772021  T
329 cgatgtgggactcttaaca 347  Q
     |||||| |||||||||||    
35772020 tgatgtgagactcttaaca 35772002  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #37
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 229 - 347
Target Start/End: Complemental strand, 30369920 - 30369802
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| |||||||||||||||||||||||| |||||   ||| |||| ||||||||||||| ||||||||||| |||||| |  ||| || ||||    
30369920 tcttagaaatcgtggttgggcctaacacaaccccacaaaactatcttgtgaggtgaggattgcccctacttataaacatattgtcggaccatctcatatc 30369821  T
329 cgatgtgggactcttaaca 347  Q
    |||||||| ||||||||||    
30369820 cgatgtggaactcttaaca 30369802  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #38
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 229 - 335
Target Start/End: Original strand, 39348352 - 39348457
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| ||| |||||||||||||||||||| |||||||| || |||| |||||||||||||||||||||||||| |||||| | ||| |||||||    
39348352 tcttagaaatcgtg-ttgggcctaacacaaccccacaaaaccggtttgtgaggtgaggattgcccccacttataaacacgttgtcaagccatctcctatc 39348450  T
329 cgatgtg 335  Q
     ||||||    
39348451 tgatgtg 39348457  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #39
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 229 - 347
Target Start/End: Complemental strand, 43409891 - 43409774
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| |||||||| | ||||||||||||  ||||||||||| |||| |||| |||||||| ||||||||| ||||||||||  ||||| |||||    
43409891 tcttagaaatcgtggttggacataacacaaccccccaaaaccggcttgtgaggtgagaattgcccc-acttataaatacattgtcagaccatgttctatc 43409793  T
329 cgatgtgggactcttaaca 347  Q
    ||||||| |||||||||||    
43409792 cgatgtgagactcttaaca 43409774  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #40
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 229 - 314
Target Start/End: Complemental strand, 38668210 - 38668125
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtca 314  Q
    |||||||||| ||| |||||||||||||||||||| ||||  ||||| |||||||| |||||||||||||||||||||||||||||    
38668210 tcttagaaattgtgattgggcctaacacaaccccacaaaattggcttgtgagatgatgattgcccccacttataaacacattgtca 38668125  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #41
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 231 - 315
Target Start/End: Complemental strand, 51589889 - 51589805
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcag 315  Q
    |||||||| |||||||||||||||||||||||| |||| |||||| |||| |||||||||||| |||||||||||| ||||||||    
51589889 ttagaaatcgtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgaggattgccctcacttataaacaaattgtcag 51589805  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #42
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 231 - 347
Target Start/End: Complemental strand, 52127803 - 52127688
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccg 330  Q
    |||||||| |||||||| ||||||||||||||| |||| | |||| |||| ||||||||| ||||||||||||||| ||| | ||||||  ||||| |||    
52127803 ttagaaatcgtggttggacctaacacaaccccacaaaagcagcttgtgaggtgaggattg-ccccacttataaacaaattcttaggtcaactcctaaccg 52127705  T
331 atgtgggactcttaaca 347  Q
    |||||||||||||||||    
52127704 atgtgggactcttaaca 52127688  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #43
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 229 - 352
Target Start/End: Original strand, 4098162 - 4098285
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| ||||||||||||||||||| | || |||||||| || |||   ||||||||||||||||||||||||||| |||||   || || |||     
4098162 tcttagaaattgtggttgggcctaacacaatcacacaaaaccggtttgtgaagagaggattgcccccacttataaacacatcgtcagacgatctcatatt 4098261  T
329 cgatgtgggactcttaacaccccc 352  Q
    ||||||| ||||||||||||||||    
4098262 cgatgtgagactcttaacaccccc 4098285  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #44
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 229 - 348
Target Start/End: Complemental strand, 35892376 - 35892257
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    ||||||||||  |||||| |||||||| ||||||| |||||||| || |||| |||| |||||||||||||||||| ||||||||||  ||| |  ||||    
35892376 tcttagaaattatggttgagcctaacagaaccccacaaaaccgggttgtgaggtgagtattgcccccacttataaatacattgtcagaccatcttatatc 35892277  T
329 cgatgtgggactcttaacac 348  Q
     |||||||||||||||||||    
35892276 tgatgtgggactcttaacac 35892257  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #45
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 265 - 357
Target Start/End: Original strand, 4112805 - 4112899
Alignment:
265 aaaaccggcttctgagatgaggattgcccc-cacttataaacacattgtcaggtcatgtcctatccgatgtgggactcttaacac-ccccctcac 357  Q
    |||||||| || |||| |||||||| |||| |||||||||||||||||||||| ||||||| ||||||||||||||||||||||| |||||||||    
4112805 aaaaccggtttgtgaggtgaggatttccccccacttataaacacattgtcaggccatgtcccatccgatgtgggactcttaacacaccccctcac 4112899  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #46
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 229 - 343
Target Start/End: Original strand, 21626338 - 21626452
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||  |||||||||||||| ||| ||||| |||||||| || |||  ||||||| ||||||||||||||||| ||||||||| ||| || ||||    
21626338 tcttagaaactgtggttgggcctaaaacagccccacaaaaccggattttgaagtgaggatggcccccacttataaacatattgtcaggccatctcttatc 21626437  T
329 cgatgtgggactctt 343  Q
     ||||||||||||||    
21626438 tgatgtgggactctt 21626452  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #47
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 243 - 347
Target Start/End: Original strand, 12244975 - 12245079
Alignment:
243 gttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggactct 342  Q
    ||||| ||||||||||||||| ||||||||||| |||| ||||||||||||||||||||||||| |||| |||  ||  |||||  |||||| |||||||    
12244975 gttggacctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgccagaccaactcctaatcgatgtaggactct 12245074  T
343 taaca 347  Q
    |||||    
12245075 taaca 12245079  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #48
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 244 - 348
Target Start/End: Complemental strand, 38668430 - 38668326
Alignment:
244 ttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggactctt 343  Q
    ||||||||||||||| |||| ||||||| ||| | || ||| |||||||||||||||||||||||||||||   |||  | |||||||||||||||||||    
38668430 ttgggcctaacacaatcccacaaaaccgacttgtaaggtgatgattgcccccacttataaacacattgtcaaaccatcacatatccgatgtgggactctt 38668331  T
344 aacac 348  Q
    |||||    
38668330 aacac 38668326  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #49
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 229 - 309
Target Start/End: Complemental strand, 49143038 - 49142958
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacat 309  Q
    ||||||||||||||||||||| |||||||| |||| ||||  ||||| |||| ||||||||||||||||||||||||||||    
49143038 tcttagaaatggtggttgggcataacacaatcccacaaaattggcttgtgagctgaggattgcccccacttataaacacat 49142958  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #50
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 229 - 348
Target Start/End: Complemental strand, 7653561 - 7653442
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| ||||||||||||||||||| |||| |||| | ||||||||| | |||||||||||||| |||||||| || || |||  || || |||     
7653561 tcttagaaattgtggttgggcctaacacaatcccacaaaatcagcttctgaggtaaggattgcccccacgtataaacaaatcgtgaggctatctcttatt 7653462  T
329 cgatgtgggactcttaacac 348  Q
    ||||||||||| ||||||||    
7653461 cgatgtgggacgcttaacac 7653442  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #51
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 230 - 348
Target Start/End: Original strand, 4098403 - 4098520
Alignment:
230 cttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatcc 329  Q
    ||||||||| |||||||||||||||||||||| | ||||||  ||| | || ||||||||||||||||||||||||||||| |||   ||| |  |||||    
4098403 cttagaaatcgtggttgggcctaacacaaccc-acaaaaccaacttgtaaggtgaggattgcccccacttataaacacattatcaaaccatctattatcc 4098501  T
330 gatgtgggactcttaacac 348  Q
    |||||| ||||||||||||    
4098502 gatgtgcgactcttaacac 4098520  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #52
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 229 - 344
Target Start/End: Original strand, 26173229 - 26173335
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    ||||||||||||||||||||||||||      ||| ||||||||||| |||| ||| ||||||||||||||||||||||||||||||   || || ||||    
26173229 tcttagaaatggtggttgggcctaac------ccacaaaaccggcttgtgaggtgatgattgcccccacttataaacacattgtcag---atttcttatc 26173319  T
329 cgatgtgggactctta 344  Q
     |||||||||||||||    
26173320 tgatgtgggactctta 26173335  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #53
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 227 - 309
Target Start/End: Complemental strand, 32223850 - 32223768
Alignment:
227 tctcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacat 309  Q
    |||||||||||| |||||||||||| ||||||||||| | ||| ||||| |||||||||||| |||||||| |||||||||||    
32223850 tctcttagaaattgtggttgggccttacacaaccccacacaactggcttgtgagatgaggatcgcccccacatataaacacat 32223768  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #54
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 229 - 295
Target Start/End: Complemental strand, 33156818 - 33156752
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgccccc 295  Q
    |||||||||| |||||||||||||||||||||||| |||||||| || |||||||||||||||||||    
33156818 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccggtttgtgagatgaggattgccccc 33156752  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #55
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 282 - 348
Target Start/End: Original strand, 51459882 - 51459948
Alignment:
282 tgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggactcttaacac 348  Q
    ||||||||||||||||||||||||||||||| ||| |||  ||||||||||||||||||||||||||    
51459882 tgaggattgcccccacttataaacacattgttaggccatcacctatccgatgtgggactcttaacac 51459948  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #56
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 244 - 348
Target Start/End: Complemental strand, 3170071 - 3169966
Alignment:
244 ttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttat-aaacacattgtcaggtcatgtcctatccgatgtgggactct 342  Q
    ||||| |||||||||||||| ||||||||||| |||| | |||||||||| ||||||| ||||| ||||||||  ||  ||||| |||||||||||||||    
3170071 ttgggtctaacacaaccccacaaaaccggcttgtgaggtaaggattgccctcacttataaaacaaattgtcagaccaactcctaaccgatgtgggactct 3169972  T
343 taacac 348  Q
    ||||||    
3169971 taacac 3169966  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #57
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 229 - 345
Target Start/End: Complemental strand, 16163018 - 16162902
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    ||||| |||| ||||||| | |||||||||||||| |||| ||| || |||| ||||| ||| ||||||||| ||||||||||||||| |||  | ||||    
16163018 tcttaaaaattgtggttgagtctaacacaaccccacaaaatcggtttatgaggtgaggtttgtccccacttaaaaacacattgtcaggccatcacatatc 16162919  T
329 cgatgtgggactcttaa 345  Q
    ||||||| |||||||||    
16162918 cgatgtgagactcttaa 16162902  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #58
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 240 - 343
Target Start/End: Complemental strand, 17468419 - 17468315
Alignment:
240 gtggttgggcctaacacaacccc-ataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtggga 338  Q
    ||||||||||| ||||||||||| | | ||| | ||  |||||||||||||||||||||||||||||| ||||||||  ||| || ||||||||||||||    
17468419 gtggttgggcccaacacaacccccacataacggactggtgagatgaggattgcccccacttataaacatattgtcagaccatctcttatccgatgtggga 17468320  T
339 ctctt 343  Q
    |||||    
17468319 ctctt 17468315  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #59
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 231 - 357
Target Start/End: Complemental strand, 51590121 - 51589996
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccg 330  Q
    |||||||| ||| ||||||||||||||| |||| ||||||||||| |||| |||||||||  | |||||||||||| ||||||||   |  ||||| | |    
51590121 ttagaaatcgtgcttgggcctaacacaatcccacaaaaccggcttgtgaggtgaggattg--ctcacttataaacaaattgtcagacaaactcctaactg 51590024  T
331 atgtgggactcttaacac-ccccctcac 357  Q
    |||||||||||||||||| |||||||||    
51590023 atgtgggactcttaacacaccccctcac 51589996  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #60
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 229 - 348
Target Start/End: Complemental strand, 7307806 - 7307687
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    ||||||||||  ||||| ||||||||| || || | ||||||| ||| |||| |||| |||||| ||||||||||||||||||| ||||||| |  | ||    
7307806 tcttagaaattatggttaggcctaacataatccaacaaaaccgacttgtgaggtgagaattgcctccacttataaacacattgttaggtcatcttatgtc 7307707  T
329 cgatgtgggactcttaacac 348  Q
    |||||| |||||||||||||    
7307706 cgatgttggactcttaacac 7307687  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #61
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 229 - 348
Target Start/End: Complemental strand, 27413432 - 27413313
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| |||||||| |||||||||||| || |||| |||||| |||| ||||||||| | ||| ||||| |||||||| |||| |||   |||||    
27413432 tcttagaaatcgtggttggacctaacacaacctcacaaaatcggcttgtgaggtgaggattgtctccagttatacacacattgccaggacatcgtctatc 27413333  T
329 cgatgtgggactcttaacac 348  Q
    | |||||||||| |||||||    
27413332 caatgtgggacttttaacac 27413313  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #62
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 229 - 343
Target Start/End: Original strand, 3477175 - 3477289
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| ||| ||| |||||| ||||||||| | || ||| || |||| | ||||| ||||||||||||||||||||| ||||| ||| ||||||     
3477175 tcttagaaatcgtgattgtgcctaatacaaccccacacaatcgggttatgaggtaaggatcgcccccacttataaacacattatcaggacatctcctatt 3477274  T
329 cgatgtgggactctt 343  Q
    |||||||||| ||||    
3477275 cgatgtgggattctt 3477289  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #63
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 229 - 347
Target Start/End: Complemental strand, 25255396 - 25255279
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| |||||||||||||||||||||||| ||||||||||| |||| |||| |||| |  ||||| ||||||||||||  |  ||| || |||     
25255396 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgagaattgtcatcactt-taaacacattgtttgaccatctcttatt 25255298  T
329 cgatgtgggactcttaaca 347  Q
    ||||||| |||||||||||    
25255297 cgatgtgagactcttaaca 25255279  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #64
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 234 - 347
Target Start/End: Original strand, 28408043 - 28408159
Alignment:
234 gaaatggtggttgggcctaac---acaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccg 330  Q
    ||||| ||||||||||||| |   ||||||||| ||||||||||| |||| | ||||||| ||||||||||||||| ||||||||  ||  | ||| |||    
28408043 gaaatcgtggttgggcctagcctaacaaccccacaaaaccggcttgtgaggtaaggattgtccccacttataaacaaattgtcagaccaacttctaaccg 28408142  T
331 atgtgggactcttaaca 347  Q
    |||||||||||||||||    
28408143 atgtgggactcttaaca 28408159  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #65
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 229 - 295
Target Start/End: Original strand, 31432229 - 31432295
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgccccc 295  Q
    |||||||||| ||||||||||||| |||||||||| ||||||||||| |||| ||||||||||||||    
31432229 tcttagaaatcgtggttgggcctagcacaaccccacaaaaccggcttgtgaggtgaggattgccccc 31432295  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #66
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 240 - 346
Target Start/End: Complemental strand, 39808539 - 39808434
Alignment:
240 gtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggac 339  Q
    |||||||||||||||||| ||||| |||||||| ||  | | ||||||||| ||||||||||||||||||||||||  |||  | ||||| |||||||||    
39808539 gtggttgggcctaacacagccccacaaaaccggtttggggg-tgaggattgtccccacttataaacacattgtcagaccatcacatatccaatgtgggac 39808441  T
340 tcttaac 346  Q
    |||||||    
39808440 tcttaac 39808434  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #67
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 231 - 309
Target Start/End: Original strand, 40316051 - 40316129
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacat 309  Q
    |||||||| ||||||||  ||||||||||| || ||||||||||| |||| ||||||||| ||||||||||||||||||    
40316051 ttagaaatcgtggttggatctaacacaacctcacaaaaccggcttatgaggtgaggattgaccccacttataaacacat 40316129  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #68
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 231 - 309
Target Start/End: Complemental strand, 52907467 - 52907389
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacat 309  Q
    ||||| || ||||||||| || ||||||||||| |||||| |||| |||| ||||||||||||||||||||||||||||    
52907467 ttagatatcgtggttgggtcttacacaaccccacaaaaccagcttgtgaggtgaggattgcccccacttataaacacat 52907389  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #69
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 277 - 357
Target Start/End: Original strand, 8870736 - 8870817
Alignment:
277 tgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggactcttaacac-ccccctcac 357  Q
    |||| |||||||||||||||||||||||||||||||||   |||  || ||||||||||||||||||||||| |||||||||    
8870736 tgaggtgaggattgcccccacttataaacacattgtcacaccatcaccgatccgatgtgggactcttaacacaccccctcac 8870817  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #70
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 235 - 347
Target Start/End: Complemental strand, 11925000 - 11924888
Alignment:
235 aaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgt 334  Q
    |||| ||||||||||||||||||||| || |||||||| || | || |||| | | |||||||||||||||| ||||||||  |||  ||||||||||||    
11925000 aaatcgtggttgggcctaacacaacctcacaaaaccggtttgtaaggtgagaaatacccccacttataaacatattgtcagaccatcacctatccgatgt 11924901  T
335 gggactcttaaca 347  Q
    |  ||||||||||    
11924900 gtaactcttaaca 11924888  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #71
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 229 - 320
Target Start/End: Complemental strand, 29898997 - 29898906
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcat 320  Q
    |||||||||| ||||||||||||| ||||||| || ||||||||||| || | |||| ||||||| ||||||||||||| |  |||||||||    
29898997 tcttagaaatcgtggttgggcctagcacaacctcacaaaaccggcttgtgtggtgagaattgccctcacttataaacacgtgttcaggtcat 29898906  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #72
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 229 - 347
Target Start/End: Complemental strand, 17402667 - 17402549
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    ||||| |||| ||||| |||||||||||||||| |  |||||  ||| |||| ||| |||||||| ||||| |||||| ||||||||  |||  ||||||    
17402667 tcttaaaaatcgtggtcgggcctaacacaaccctacgaaacccacttttgaggtgaagattgcccgcacttttaaacaaattgtcagaccatcacctatc 17402568  T
329 cgatgtgggactcttaaca 347  Q
    ||||||||||||| |||||    
17402567 cgatgtgggactcataaca 17402549  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #73
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 295 - 353
Target Start/End: Complemental strand, 17412586 - 17412528
Alignment:
295 cacttataaacacattgtcaggtcatgtcctatccgatgtgggactcttaacacccccc 353  Q
    |||||||||||||||||||||||||| ||||||| ||||||||||| ||||||| ||||    
17412586 cacttataaacacattgtcaggtcatctcctatctgatgtgggacttttaacacacccc 17412528  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #74
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 229 - 343
Target Start/End: Original strand, 26346968 - 26347081
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| |||||  ||| ||||||||||||| ||||| ||||| |||| ||||||||| | |||||||||||||||| ||||| |||| || |||     
26346968 tcttagaaatcgtggtgaggc-taacacaaccccacaaaacgggcttgtgaggtgaggattgtctccacttataaacacatcgtcagatcatctcttatt 26347066  T
329 cgatgtgggactctt 343  Q
    || ||||| ||||||    
26347067 cggtgtggtactctt 26347081  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #75
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 229 - 299
Target Start/End: Complemental strand, 29266038 - 29265968
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccactt 299  Q
    |||||||||| |||||||||||||||||||||||| |||||| |||| | || |||| |||||||||||||    
29266038 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccagcttgtaaggtgagtattgcccccactt 29265968  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #76
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 229 - 347
Target Start/End: Complemental strand, 32952156 - 32952038
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    ||||| |||| |||||||| ||||||||||||| | ||||||| ||| ||||   ||||||| | |||||||||||||||||||||   ||  |||||||    
32952156 tcttataaatagtggttggacctaacacaacccaaaaaaaccgacttgtgagggaaggattggctccacttataaacacattgtcaaaccaactcctatc 32952057  T
329 cgatgtgggactcttaaca 347  Q
    | |||||||| ||||||||    
32952056 caatgtgggattcttaaca 32952038  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #77
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 229 - 347
Target Start/End: Complemental strand, 38733236 - 38733119
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| |||||||  |||||||||| | || ||||||| ||| ||||||||| |||| ||| ||||||||||||||||||||  |||  | |||     
38733236 tcttagaaatcgtggttgaacctaacacaatctcacaaaaccgacttgtgagatgagaattgtccc-acttataaacacattgtcagaccatcacatatt 38733138  T
329 cgatgtgggactcttaaca 347  Q
    |||||||| ||||||||||    
38733137 cgatgtggaactcttaaca 38733119  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #78
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 282 - 347
Target Start/End: Complemental strand, 13386280 - 13386215
Alignment:
282 tgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggactcttaaca 347  Q
    |||||||| |||| ||||||| |||||||| |||| ||||||||||||||||||| ||||||||||    
13386280 tgaggattaccccaacttatatacacattgccaggccatgtcctatccgatgtggaactcttaaca 13386215  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #79
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 240 - 309
Target Start/End: Original strand, 31004447 - 31004516
Alignment:
240 gtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacat 309  Q
    ||||||||| ||||| |||||| | |||||| |||| |||| ||||||||||||||||||||||||||||    
31004447 gtggttgggtctaacgcaacccaacaaaaccagcttgtgaggtgaggattgcccccacttataaacacat 31004516  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #80
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 294 - 347
Target Start/End: Original strand, 35303504 - 35303557
Alignment:
294 ccacttataaacacattgtcaggtcatgtcctatccgatgtgggactcttaaca 347  Q
    ||||||||||| |||||||||| |||||| ||||||||||||||||||||||||    
35303504 ccacttataaatacattgtcagatcatgttctatccgatgtgggactcttaaca 35303557  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #81
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 282 - 357
Target Start/End: Original strand, 51460133 - 51460210
Alignment:
282 tgaggattgcccc-cacttataaacacattgtcaggtcatgtcctatccgatgtgggactcttaacac-ccccctcac 357  Q
    |||||||| |||| |||||||||||||||||| ||| |||  |||||||||||||||||||||||||| |||||||||    
51460133 tgaggattaccccacacttataaacacattgttaggccatcacctatccgatgtgggactcttaacacaccccctcac 51460210  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #82
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 231 - 339
Target Start/End: Complemental strand, 9499328 - 9499221
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccg 330  Q
    |||||||| ||||||| | | |||||||||||| |||||||| || |||| ||| ||||||||| ||||||||||| ||||||||   || |||||||||    
9499328 ttagaaatcgtggttgagtcgaacacaaccccacaaaaccgg-ttgtgaggtgaagattgcccctacttataaacatattgtcagactatctcctatccg 9499230  T
331 atgtgggac 339  Q
    | |||||||    
9499229 acgtgggac 9499221  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #83
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 241 - 321
Target Start/End: Complemental strand, 17402787 - 17402707
Alignment:
241 tggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatg 321  Q
    |||| ||| ||||| ||| |||| |||||||| || |||| ||||||||||||||||||||||||| ||||||||| ||||    
17402787 tggtcgggtctaacgcaatcccaaaaaaccggattttgaggtgaggattgcccccacttataaacaaattgtcaggccatg 17402707  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #84
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 229 - 305
Target Start/End: Complemental strand, 33157306 - 33157230
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaac 305  Q
    |||||||||| ||| |||||||||||||||||||| ||||||| |||  ||| || |||||| ||||||||||||||    
33157306 tcttagaaatcgtgattgggcctaacacaaccccacaaaaccgacttacgaggtggggattgtccccacttataaac 33157230  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #85
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 229 - 309
Target Start/End: Original strand, 42351859 - 42351939
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacat 309  Q
    ||||||||||  |||||||||| |||||||| ||| ||||| ||||| |||| ||||||| ||| ||||||||||||||||    
42351859 tcttagaaatcatggttgggcccaacacaacaccacaaaactggcttgtgaggtgaggatggcctccacttataaacacat 42351939  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #86
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 240 - 307
Target Start/End: Complemental strand, 11234290 - 11234223
Alignment:
240 gtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacac 307  Q
    |||||||||||||| ||||||||| ||||||||||| |||| |||| | || ||||||||||||||||    
11234290 gtggttgggcctaatacaaccccacaaaaccggcttatgaggtgagaactgtccccacttataaacac 11234223  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #87
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 229 - 320
Target Start/End: Complemental strand, 49142593 - 49142502
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcat 320  Q
    |||||||||||||||||| ||||||||||| |||| | |  || ||| |||| || ||||||||| ||||| ||||||||||||||| ||||    
49142593 tcttagaaatggtggttgagcctaacacaatcccacatattcgacttgtgaggtggggattgccctcacttctaaacacattgtcagatcat 49142502  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #88
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 229 - 347
Target Start/End: Original strand, 32783280 - 32783397
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| ||||||||  |||||| ||  |||||||||  |||| |||||||| |||||||||| |||||||||||| |||||   ||| |  ||||    
32783280 tcttagaaatcgtggttggatctaacaaaattccataaaactagcttgtgagatgaagattgcccccgcttataaacaca-tgtcaaaccatctattatc 32783378  T
329 cgatgtgggactcttaaca 347  Q
    ||||||| |||||||||||    
32783379 cgatgtgagactcttaaca 32783397  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #89
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 297 - 347
Target Start/End: Complemental strand, 33156455 - 33156405
Alignment:
297 cttataaacacattgtcaggtcatgtcctatccgatgtgggactcttaaca 347  Q
    |||||||||||||||||||||||| ||| || |||||||||||||||||||    
33156455 cttataaacacattgtcaggtcatctccaatacgatgtgggactcttaaca 33156405  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #90
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 286 - 348
Target Start/End: Original strand, 51460263 - 51460325
Alignment:
286 gattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggactcttaacac 348  Q
    ||||||||| ||||||||||||||||| |||||||  |||||| ||||| |||||||||||||    
51460263 gattgcccctacttataaacacattgttaggtcatcacctatctgatgttggactcttaacac 51460325  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #91
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 297 - 357
Target Start/End: Complemental strand, 33156986 - 33156925
Alignment:
297 cttataaacacattgtcaggtcatgtcctatccgatgtgggactcttaacac-ccccctcac 357  Q
    |||||||||||||||||||  ||| ||||||||||||||| ||||||||||| |||||||||    
33156986 cttataaacacattgtcagaccatctcctatccgatgtggaactcttaacacgccccctcac 33156925  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #92
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 230 - 315
Target Start/End: Original strand, 34264710 - 34264795
Alignment:
230 cttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcag 315  Q
    ||||||||| |||||||| |||| |||||| | | ||||| | ||| ||||||| |||||  ||||||||||||||||||||||||    
34264710 cttagaaatcgtggttggacctagcacaactctacaaaactgacttgtgagatgtggattatccccacttataaacacattgtcag 34264795  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #93
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 229 - 306
Target Start/End: Original strand, 40188984 - 40189061
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaaca 306  Q
    |||||||| | |||||||||||| ||||||||||| ||||||| ||| |||| |||||| | |||| |||||||||||    
40188984 tcttagaatttgtggttgggcctgacacaaccccacaaaaccgacttgtgagttgaggacttcccctacttataaaca 40189061  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #94
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 282 - 346
Target Start/End: Complemental strand, 369667 - 369603
Alignment:
282 tgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggactcttaac 346  Q
    ||||||||||||||||||||||||||||| ||||   || ||||  |||||||||||||||||||    
369667 tgaggattgcccccacttataaacacattttcagactatctcctgcccgatgtgggactcttaac 369603  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #95
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 267 - 343
Target Start/End: Original strand, 7826068 - 7826144
Alignment:
267 aaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggactctt 343  Q
    ||||||||| |||| | ||||||| ||||||||||||||||||||||||  ||| |  ||| |||||||||||||||    
7826068 aaccggcttgtgaggtaaggattgtccccacttataaacacattgtcagaccatcttttattcgatgtgggactctt 7826144  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #96
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 247 - 347
Target Start/End: Complemental strand, 26603495 - 26603395
Alignment:
247 ggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggactcttaac 346  Q
    ||||||| | ||||||| ||||||||||| |||| |||||||||  ||   ||||||||| ||||||||  ||| |||||| ||||||| ||||||||||    
26603495 ggcctaatataaccccacaaaaccggcttatgaggtgaggattgtaccattttataaacatattgtcagaccatctcctattcgatgtgagactcttaac 26603396  T
347 a 347  Q
    |    
26603395 a 26603395  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #97
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 229 - 305
Target Start/End: Original strand, 50695833 - 50695909
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaac 305  Q
    |||||||| | ||| || |||||||| |||||||| ||||||||||| |||| |||||||| ||| |||||||||||    
50695833 tcttagaatttgtgcttaggcctaactcaaccccacaaaaccggcttgtgagctgaggattaccctcacttataaac 50695909  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #98
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 7 - 42
Target Start/End: Original strand, 4382929 - 4382964
Alignment:
7 ataatataatttgagtgtttggtgtatttcagtttt 42  Q
    ||||||||||||||||||||||||||||||||||||    
4382929 ataatataatttgagtgtttggtgtatttcagtttt 4382964  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #99
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 241 - 343
Target Start/End: Complemental strand, 22100156 - 22100053
Alignment:
241 tggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgccccc-acttataaacacattgtcaggtcatgtcctatccgatgtgggac 339  Q
    |||||||||| ||||||||  || ||||| | ||| |||| ||| |||| ||||| ||||||||||||||||||||||||| |  |||| ||||| ||||    
22100156 tggttgggcccaacacaacttcaaaaaacagtcttttgaggtgatgattaccccccacttataaacacattgtcaggtcatctaatatcggatgtaggac 22100057  T
340 tctt 343  Q
    ||||    
22100056 tctt 22100053  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #100
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 229 - 304
Target Start/End: Complemental strand, 22377617 - 22377542
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaa 304  Q
    |||||||||| ||||||||| |||||| |||| || ||||||| |||  ||| ||| |||||||||||||||||||    
22377617 tcttagaaatcgtggttgggactaacataaccgcacaaaaccgacttgcgaggtgatgattgcccccacttataaa 22377542  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #101
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 229 - 307
Target Start/End: Complemental strand, 11525082 - 11525004
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacac 307  Q
    |||||||||| |||| |||||||||||||||| || |||||||| || || | |||| ||||||||  |||||||||||    
11525082 tcttagaaattgtggatgggcctaacacaacctcacaaaaccggattgtggggtgagcattgcccctgcttataaacac 11525004  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #102
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 251 - 353
Target Start/End: Original strand, 12488987 - 12489089
Alignment:
251 taacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggactcttaacaccc 350  Q
    |||||||||||||||||| | | || |||  ||| |||||  || ||||||||||| ||||||||||||| ||||||| ||||| | |||| |||||| |    
12488987 taacacaaccccataaaatcagtttgtgaagtgatgattgttccgacttataaacatattgtcaggtcatctcctatctgatgtcgaactcataacacac 12489086  T
351 ccc 353  Q
    |||    
12489087 ccc 12489089  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #103
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 266 - 307
Target Start/End: Original strand, 7465681 - 7465722
Alignment:
266 aaaccggcttctgagatgaggattgcccccacttataaacac 307  Q
    |||||||||| |||| ||||||||||||||||||||||||||    
7465681 aaaccggcttgtgaggtgaggattgcccccacttataaacac 7465722  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #104
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 285 - 346
Target Start/End: Complemental strand, 17412365 - 17412304
Alignment:
285 ggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggactcttaac 346  Q
    |||||| ||||||||||||||||||| ||||   || |||||||||||||| ||||||||||    
17412365 ggattgtccccacttataaacacattatcagacaatctcctatccgatgtgagactcttaac 17412304  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #105
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 229 - 266
Target Start/End: Original strand, 51460049 - 51460086
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataa 266  Q
    |||||||||| |||||||||||||||||||||||||||    
51460049 tcttagaaattgtggttgggcctaacacaaccccataa 51460086  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #106
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 246 - 357
Target Start/End: Original strand, 9146570 - 9146682
Alignment:
246 gggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggactc-tta 344  Q
    |||||||||||||||| | |||||||  || |||| ||||||||||||||| ||||| ||||||  ||||  ||| |  | ||||||||||||||| | |    
9146570 gggcctaacacaacccaacaaaaccgttttgtgaggtgaggattgcccccagttatatacacatgttcagaccatcttttgtccgatgtgggactcgtga 9146669  T
345 acacccccctcac 357  Q
    |||| ||||||||    
9146670 acacacccctcac 9146682  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #107
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 241 - 309
Target Start/End: Complemental strand, 26229641 - 26229573
Alignment:
241 tggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacat 309  Q
    ||||||| ||||||||||||| | ||| ||| ||| |||| |||||||||||  |||||||||||||||    
26229641 tggttggacctaacacaaccctaaaaatccgacttatgaggtgaggattgccttcacttataaacacat 26229573  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #108
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 229 - 309
Target Start/End: Complemental strand, 41067024 - 41066944
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacat 309  Q
    ||||| |||| |||||||||||||| |||| |||| | |||||| || |||| ||| |||| || ||||||||||||||||    
41067024 tcttataaattgtggttgggcctaaaacaagcccacacaaccggtttgtgaggtgaagattacctccacttataaacacat 41066944  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #109
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 231 - 307
Target Start/End: Original strand, 51460443 - 51460519
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacac 307  Q
    ||||||||  ||||||||||||||||||||||| ||||| ||||| | |  ||| |||| || ||||||||||||||    
51460443 ttagaaattatggttgggcctaacacaaccccacaaaactggcttgtaaagtgaagattaccaccacttataaacac 51460519  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #110
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 230 - 289
Target Start/End: Original strand, 12376673 - 12376732
Alignment:
230 cttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggatt 289  Q
    ||||||||| || ||||| |||||| ||||||||||||| |||||| |||| ||||||||    
12376673 cttagaaatcgtcgttggacctaactcaaccccataaaaacggcttgtgaggtgaggatt 12376732  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #111
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 234 - 309
Target Start/End: Complemental strand, 16173283 - 16173210
Alignment:
234 gaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacat 309  Q
    |||||| ||||||| | ||||||||||||| ||||||||||  |||| ||||||||||| || |||||||||||||    
16173283 gaaatgatggttgg-cttaacacaacccca-aaaaccggctagtgaggtgaggattgcctccgcttataaacacat 16173210  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #112
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 250 - 312
Target Start/End: Complemental strand, 9830644 - 9830582
Alignment:
250 ctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgt 312  Q
    ||||||||||| ||||||| |||||| |||| ||||||||||||  |||||| || |||||||    
9830644 ctaacacaacctcataaaatcggcttgtgagctgaggattgcccttacttatcaaaacattgt 9830582  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #113
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 229 - 263
Target Start/End: Original strand, 20208228 - 20208262
Alignment:
229 tcttagaaatggtggttgggcctaacacaacccca 263  Q
    |||||||||| ||||||||||||||||||||||||    
20208228 tcttagaaatcgtggttgggcctaacacaacccca 20208262  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #114
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 229 - 275
Target Start/End: Original strand, 31496370 - 31496416
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggctt 275  Q
    |||||||||| ||| ||| | ||||||||||||||||||||||||||    
31496370 tcttagaaatcgtgattgagtctaacacaaccccataaaaccggctt 31496416  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #115
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 229 - 310
Target Start/End: Complemental strand, 5109569 - 5109488
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacatt 310  Q
    |||||||||| |||| ||||||||||||||   || ||||||  ||| |||| |||||||| | || |||||||||||||||    
5109569 tcttagaaattgtggatgggcctaacacaatatcacaaaacccacttgtgaggtgaggattacaccgacttataaacacatt 5109488  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #116
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 229 - 306
Target Start/End: Original strand, 9146863 - 9146940
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaaca 306  Q
    ||||||||||  |||||| || || |||||| ||| ||||||||||| ||||  |||||||| |||| ||||||||||    
9146863 tcttagaaattatggttgagcgtagcacaactccacaaaaccggcttgtgaggagaggattgaccccgcttataaaca 9146940  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #117
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 230 - 307
Target Start/End: Complemental strand, 11525296 - 11525219
Alignment:
230 cttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacac 307  Q
    ||||||||| || | |||||||||||||||| || |||||||| || || | |||| ||||||||  |||||||||||    
11525296 cttagaaattgttgatgggcctaacacaacctcacaaaaccggattgtggggtgagcattgcccctgcttataaacac 11525219  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #118
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 282 - 354
Target Start/End: Original strand, 31496189 - 31496260
Alignment:
282 tgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggactcttaacacccccct 354  Q
    ||||||||| || |||||||||||||||||||| ||||| | ||||| ||  ||| ||||||||||| |||||    
31496189 tgaggattgtcctcacttataaacacattgtcatgtcatcttctatctga-atggaactcttaacacacccct 31496260  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #119
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 229 - 304
Target Start/End: Complemental strand, 39544479 - 39544406
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaa 304  Q
    ||||||||||||||||||||||  ||||||||||| ||||||  ||| | |  ||||||||| ||||| |||||||    
39544479 tcttagaaatggtggttgggcc--acacaaccccacaaaaccaacttgtaaagtgaggattgtccccatttataaa 39544406  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 111; Significance: 6e-56; HSPs: 118)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 111; E-Value: 6e-56
Query Start/End: Original strand, 227 - 357
Target Start/End: Complemental strand, 35788981 - 35788851
Alignment:
227 tctcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtccta 326  Q
    |||||||||||| |||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||| |||    
35788981 tctcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgagatgaggattgcccccacttataaacacattgtcaggccatgttcta 35788882  T
327 tccgatgtgggactcttaacacccccctcac 357  Q
    |||||||||||||||||||||||||||||||    
35788881 tccgatgtgggactcttaacacccccctcac 35788851  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 229 - 348
Target Start/End: Original strand, 39902562 - 39902681
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    ||||||||||||||||||||||||||||||||||| |||||| |||| |||| ||||||||||||||||||||||||||||||||||| |||||||||||    
39902562 tcttagaaatggtggttgggcctaacacaaccccacaaaaccagcttgtgaggtgaggattgcccccacttataaacacattgtcaggccatgtcctatc 39902661  T
329 cgatgtgggactcttaacac 348  Q
    ||||||||||||||||||||    
39902662 cgatgtgggactcttaacac 39902681  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 99; E-Value: 9e-49
Query Start/End: Original strand, 229 - 347
Target Start/End: Complemental strand, 35788744 - 35788626
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| |||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||| |||||||||||    
35788744 tcttagaaatcgtggttgggcctaacacaaccccataaaaccggcttgtgaggtgaggattgcccccacttataaacacattgtcaggccatgtcctatc 35788645  T
329 cgatgtgggactcttaaca 347  Q
     ||||||||||||||||||    
35788644 tgatgtgggactcttaaca 35788626  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 228 - 347
Target Start/End: Original strand, 22845445 - 22845564
Alignment:
228 ctcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctat 327  Q
    ||||||||||| |||||||||||||||||||||||| ||||||||||| |||| |||||||| |||||||||||||||||||||||||| |||||| |||    
22845445 ctcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattacccccacttataaacacattgtcaggccatgtcatat 22845544  T
328 ccgatgtgggactcttaaca 347  Q
    | ||||||||||||||||||    
22845545 ctgatgtgggactcttaaca 22845564  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 84; E-Value: 8e-40
Query Start/End: Original strand, 231 - 357
Target Start/End: Complemental strand, 21498878 - 21498751
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccg 330  Q
    |||||||| |||||||||||||||||||||||| ||||||||||| |||| ||||||||||||||||||||||||| ||||||||| ||  ||||| |||    
21498878 ttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcaggccaactcctaaccg 21498779  T
331 atgtgggactcttaacac-ccccctcac 357  Q
    |||||||||||||||||| |||||||||    
21498778 atgtgggactcttaacacaccccctcac 21498751  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 84; E-Value: 8e-40
Query Start/End: Original strand, 227 - 357
Target Start/End: Original strand, 35796739 - 35796870
Alignment:
227 tctcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtccta 326  Q
    ||||||||||||||||||||| | |||||||||| || ||||||||||| |||| ||||||||||||||||||||||||||||||||| | ||||||||     
35796739 tctcttagaaatggtggttggacttaacacaacctcacaaaaccggcttgtgaggtgaggattgcccccacttataaacacattgtcatgccatgtcctg 35796838  T
327 tccgatgtgggactcttaacac-ccccctcac 357  Q
    |||||||||| ||||||||||| |||||||||    
35796839 tccgatgtggaactcttaacacaccccctcac 35796870  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 229 - 343
Target Start/End: Complemental strand, 22827623 - 22827509
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| |||||||||||||||||||||| | ||||||||||| |||| |||||||||||||||||||||||||| |||||||| ||| |||||||    
22827623 tcttagaaatcgtggttgggcctaacacaacccgacaaaaccggcttgtgaggtgaggattgcccccacttataaacacgttgtcaggccatctcctatc 22827524  T
329 cgatgtgggactctt 343  Q
    |||||||||||||||    
22827523 cgatgtgggactctt 22827509  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 231 - 353
Target Start/End: Original strand, 28245527 - 28245649
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccg 330  Q
    |||||||| || ||||||||||||||||||||| ||||||||||| |||| ||||||||||||||||||||||||||||||||||| |||  ||||||||    
28245527 ttagaaatcgtagttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacacattgtcaggccatcacctatccg 28245626  T
331 atgtgggactcttaacacccccc 353  Q
    ||||| |||||||||||| ||||    
28245627 atgtgagactcttaacacacccc 28245649  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 229 - 347
Target Start/End: Original strand, 50543566 - 50543684
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| |||||||||||||||||||| ||| ||||||||||| |||| ||||||||||||||||||||| ||||||||||||| |||  ||||||    
50543566 tcttagaaatcgtggttgggcctaacacaactccacaaaaccggcttgtgaggtgaggattgcccccacttatacacacattgtcaggccatcacctatc 50543665  T
329 cgatgtgggactcttaaca 347  Q
    |||||||||||||||||||    
50543666 cgatgtgggactcttaaca 50543684  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 81; E-Value: 5e-38
Query Start/End: Original strand, 227 - 347
Target Start/End: Complemental strand, 22863561 - 22863441
Alignment:
227 tctcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtccta 326  Q
    |||||||||||| |||||||||||||||||||||||| ||||||||||| || | ||||||||||||||||||||||||||||||||||| ||| | ||     
22863561 tctcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtggggtgaggattgcccccacttataaacacattgtcaggccatcttctg 22863462  T
327 tccgatgtgggactcttaaca 347  Q
    ||||||||| |||||||||||    
22863461 tccgatgtgagactcttaaca 22863441  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 229 - 348
Target Start/End: Original strand, 22231072 - 22231191
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| |||||||| ||||| ||||||||| ||||||||||| |||| ||||||||| ||||||||||||||||||||||||| ||| |||||||    
22231072 tcttagaaatcgtggttggacctaatacaaccccacaaaaccggcttgtgaggtgaggattgtccccacttataaacacattgtcaggccatatcctatc 22231171  T
329 cgatgtgggactcttaacac 348  Q
    |||||| |||||||||||||    
22231172 cgatgtaggactcttaacac 22231191  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 229 - 348
Target Start/End: Original strand, 22231307 - 22231426
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| |||||||||||||||||||||||| ||||||||||| |||| ||||||||||||||||||||||| | ||| ||||||||| || ||||    
22231307 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaatatattctcaggtcatatcatatc 22231406  T
329 cgatgtgggactcttaacac 348  Q
    |||||| |||||||||||||    
22231407 cgatgtaggactcttaacac 22231426  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 79; E-Value: 8e-37
Query Start/End: Original strand, 229 - 347
Target Start/End: Complemental strand, 1518249 - 1518131
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| |||||| ||||||||||||||||| ||||||||||| |||| ||||||||||||||||||||||||| ||||||||||||  ||||| |    
1518249 tcttagaaatcgtggttaggcctaacacaaccccacaaaaccggcttgtgagctgaggattgcccccacttataaacaaattgtcaggtcaactcctaac 1518150  T
329 cgatgtgggactcttaaca 347  Q
    ||||||||||||| |||||    
1518149 cgatgtgggactcataaca 1518131  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 79; E-Value: 8e-37
Query Start/End: Original strand, 231 - 353
Target Start/End: Complemental strand, 9685715 - 9685593
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccg 330  Q
    |||||||| |||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||| ||||| ||  ||  ||||| |||    
9685715 ttagaaatcgtggttgggcctaacacaaccccataaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgttagaccaactcctaaccg 9685616  T
331 atgtgggactcttaacacccccc 353  Q
    ||| |||||||||||||||||||    
9685615 atgcgggactcttaacacccccc 9685593  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 79; E-Value: 8e-37
Query Start/End: Original strand, 229 - 347
Target Start/End: Complemental strand, 52559652 - 52559534
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    ||||||||||  ||||||||||||||||||||||| ||||||||||| |||| ||| |||||||||||||||||||||||||||||||||||||| ||||    
52559652 tcttagaaatcatggttgggcctaacacaaccccacaaaaccggcttgtgaggtgatgattgcccccacttataaacacattgtcaggtcatgtcatatc 52559553  T
329 cgatgtgggactcttaaca 347  Q
    | ||||| |||| ||||||    
52559552 caatgtgagacttttaaca 52559534  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 229 - 357
Target Start/End: Complemental strand, 6218524 - 6218395
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| ||||||| |||||||||||  ||||||||||||||| |||| ||| ||||||||||||||||||||||||||| ||||||| |||||||    
6218524 tcttagaaatcgtggttgagcctaacacaattccataaaaccggcttgtgaggtgatgattgcccccacttataaacacattgttaggtcatctcctatc 6218425  T
329 cgatgtgggactcttaacac-ccccctcac 357  Q
     |||||| |||||||||||| |||||||||    
6218424 tgatgtgagactcttaacacaccccctcac 6218395  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 229 - 357
Target Start/End: Original strand, 50543329 - 50543458
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| |||||||||||||||||||||||| ||||||||||| || | ||||||||||||||||||||| ||||||||||||  |||  ||||||    
50543329 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtggggtgaggattgcccccacttatacacacattgtcagaccatcacctatc 50543428  T
329 cgatgtgggactcttaacac-ccccctcac 357  Q
    ||||||||| |||||||||| |||||||||    
50543429 cgatgtggggctcttaacacaccccctcac 50543458  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #18
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 231 - 347
Target Start/End: Complemental strand, 21498437 - 21498321
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccg 330  Q
    |||||||| |||||||||||||||| ||||||| ||||||||||| |||| ||||||||||||||||||||||||| ||||||||| ||  ||||| |||    
21498437 ttagaaatcgtggttgggcctaacataaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcaggccaactcctaaccg 21498338  T
331 atgtgggactcttaaca 347  Q
    |||||||||||||||||    
21498337 atgtgggactcttaaca 21498321  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #19
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 229 - 347
Target Start/End: Complemental strand, 21685083 - 21684965
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| |||||||||| ||||||||||||| |||| |||||| |||| ||||||||   |||||||||||||||||||||||| |||||||||||    
21685083 tcttagaaattgtggttgggcttaacacaaccccacaaaatcggcttgtgaggtgaggatttatcccacttataaacacattgtcaggccatgtcctatc 21684984  T
329 cgatgtgggactcttaaca 347  Q
    ||||||| |||||||||||    
21684983 cgatgtgagactcttaaca 21684965  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #20
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 229 - 347
Target Start/End: Original strand, 53828522 - 53828640
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| |||||||||||||||||||||||| |||| |||||| |||| ||||||||||||||||||||||||| ||||||||| ||  ||||| |    
53828522 tcttagaaattgtggttgggcctaacacaaccccacaaaatcggcttatgaggtgaggattgcccccacttataaacaaattgtcaggccaactcctaac 53828621  T
329 cgatgtgggactcttaaca 347  Q
    |||||||| ||||||||||    
53828622 cgatgtggaactcttaaca 53828640  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #21
Raw Score: 74; E-Value: 7e-34
Query Start/End: Original strand, 231 - 348
Target Start/End: Complemental strand, 20822056 - 20821939
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccg 330  Q
    |||||||| ||||||||||||||||||| |||| ||||||||||| |||| |||| |||||||||||||||||||| ||||||||| ||  ||||| |||    
20822056 ttagaaatcgtggttgggcctaacacaatcccacaaaaccggcttgtgaggtgagaattgcccccacttataaacaaattgtcaggccaactcctaaccg 20821957  T
331 atgtgggactcttaacac 348  Q
    ||||||||||||||||||    
20821956 atgtgggactcttaacac 20821939  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #22
Raw Score: 74; E-Value: 7e-34
Query Start/End: Original strand, 229 - 361
Target Start/End: Complemental strand, 52559889 - 52559756
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    ||||||||||  ||||||||||||| |||| || | ||||||||||| |||| |||| ||||| |||||||||||||||||||||| |||||||||||||    
52559889 tcttagaaatcatggttgggcctaatacaatcctacaaaaccggcttgtgaggtgagaattgctcccacttataaacacattgtcaagtcatgtcctatc 52559790  T
329 cgatgtgggactcttaacac-ccccctcacaacc 361  Q
    |||||||||| | ||||||| |||||||||||||    
52559789 cgatgtgggatttttaacacaccccctcacaacc 52559756  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #23
Raw Score: 74; E-Value: 7e-34
Query Start/End: Original strand, 229 - 357
Target Start/End: Original strand, 53828288 - 53828417
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| ||| |||||||||||||||||||| |||| ||| || |||| ||||||||||||||||||||||||| ||||||||| ||  ||||| |    
53828288 tcttagaaattgtgattgggcctaacacaaccccacaaaatcggtttatgaggtgaggattgcccccacttataaacaaattgtcaggccaactcctaac 53828387  T
329 cgatgtgggactcttaacac-ccccctcac 357  Q
    |||||||||||||||||||| |||||||||    
53828388 cgatgtgggactcttaacacaccccctcac 53828417  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #24
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 231 - 347
Target Start/End: Complemental strand, 25052935 - 25052819
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccg 330  Q
    |||||||| |||||||||||||||||||||||| ||||||||||| |||| || ||||| |||||||||||||||| ||||||||| ||  ||||| |||    
25052935 ttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgcggattacccccacttataaacaaattgtcaggccaattcctaaccg 25052836  T
331 atgtgggactcttaaca 347  Q
    |||||||||||||||||    
25052835 atgtgggactcttaaca 25052819  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #25
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 229 - 345
Target Start/End: Complemental strand, 37836165 - 37836049
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| |||||| ||||||||||||||||| ||||||||||| | ||  |||||||||||||||||||||| ||||||| ||| |||||||| ||    
37836165 tcttagaaattgtggttaggcctaacacaaccccacaaaaccggcttgtaaggagaggattgcccccacttataaatacattgttaggccatgtcctgtc 37836066  T
329 cgatgtgggactcttaa 345  Q
    |||||||||||||||||    
37836065 cgatgtgggactcttaa 37836049  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #26
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 229 - 348
Target Start/End: Original strand, 35796976 - 35797095
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    ||||||||||||| ||||||| ||||||||||||| ||||| || || |||| ||||||||||||||||||||||||| ||||||| ||||| |||| ||    
35796976 tcttagaaatggtagttgggcttaacacaaccccacaaaactggtttgtgaggtgaggattgcccccacttataaacatattgtcatgtcatctcctgtc 35797075  T
329 cgatgtgggactcttaacac 348  Q
    |||| |||||||||||||||    
35797076 cgatatgggactcttaacac 35797095  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #27
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 231 - 357
Target Start/End: Original strand, 54054806 - 54054932
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccg 330  Q
    |||||||| |||||||||||||||||||||||| |||| |||||| |||| |||| |||||||||||||||||||| ||||| ||||||  |||||  ||    
54054806 ttagaaatcgtggttgggcctaacacaaccccacaaaaacggcttatgaggtgagaattgcccccacttataaacaaattgttaggtcaactcctaatcg 54054905  T
331 atgtgggactcttaacacccccctcac 357  Q
    |||||||||||||||||  ||||||||    
54054906 atgtgggactcttaacatgcccctcac 54054932  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #28
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 240 - 357
Target Start/End: Original strand, 5398222 - 5398338
Alignment:
240 gtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggac 339  Q
    |||||||||||||||||||||||| ||||||||||| |||||||||||||| |||| |||||||||||||||||||  |||| | | ||| |||||||||    
5398222 gtggttgggcctaacacaaccccacaaaaccggcttgtgagatgaggattg-cccctcttataaacacattgtcagaccatgacttgtccaatgtgggac 5398320  T
340 tcttaacacccccctcac 357  Q
    ||||||||| ||||||||    
5398321 tcttaacacacccctcac 5398338  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #29
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 242 - 347
Target Start/End: Complemental strand, 9279299 - 9279194
Alignment:
242 ggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggactc 341  Q
    |||||||||||||||||||||| ||||||||||  |||| ||| ||||||||||||||||||||||||||||||| |||  ||||||||||||| |||||    
9279299 ggttgggcctaacacaaccccacaaaaccggctagtgaggtgatgattgcccccacttataaacacattgtcaggccatcacctatccgatgtgcgactc 9279200  T
342 ttaaca 347  Q
    ||||||    
9279199 ttaaca 9279194  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #30
Raw Score: 69; E-Value: 7e-31
Query Start/End: Original strand, 231 - 347
Target Start/End: Original strand, 14783188 - 14783304
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccg 330  Q
    |||||||| |||||||||||||||||||||||| ||||||||||| |||| ||| |||||||| || ||||||||| |||||||| |||  ||||| |||    
14783188 ttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgatgattgcccacagttataaacaaattgtcagatcaactcctaaccg 14783287  T
331 atgtgggactcttaaca 347  Q
    |||||||||||||||||    
14783288 atgtgggactcttaaca 14783304  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #31
Raw Score: 69; E-Value: 7e-31
Query Start/End: Original strand, 277 - 353
Target Start/End: Original strand, 27634128 - 27634204
Alignment:
277 tgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggactcttaacacccccc 353  Q
    |||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
27634128 tgaggtgaggattgcccccacttataaacacattgtcaggccatgtcctatccgatgtgggactcttaacacccccc 27634204  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #32
Raw Score: 69; E-Value: 7e-31
Query Start/End: Original strand, 231 - 347
Target Start/End: Original strand, 53814930 - 53815046
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccg 330  Q
    |||||||| |||||||||| ||||||||||||| ||||||| ||| |||| ||||||||||||||||||||||||| ||||||||| ||  ||||| |||    
53814930 ttagaaatcgtggttgggcttaacacaaccccacaaaaccgacttgtgaggtgaggattgcccccacttataaacaaattgtcaggccaactcctaaccg 53815029  T
331 atgtgggactcttaaca 347  Q
    |||||| ||||||||||    
53815030 atgtggaactcttaaca 53815046  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #33
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 229 - 348
Target Start/End: Original strand, 11036510 - 11036629
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| ||||||||| |||||||||||||  ||||||||||| |||| ||| ||||||||| ||||||||||||||||||| |||||  ||||||    
11036510 tcttagaaattgtggttgggtctaacacaaccccgcaaaaccggcttgtgaggtgatgattgccccaacttataaacacattgtcatgtcatcacctatc 11036609  T
329 cgatgtgggactcttaacac 348  Q
     ||| |||||||||||||||    
11036610 tgatttgggactcttaacac 11036629  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #34
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 229 - 347
Target Start/End: Original strand, 11036745 - 11036863
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    ||||| |||| |||||| ||||||||||||||||| | || |||||| |||| ||||||||||||||||||||||||||||||||||| |||  ||||||    
11036745 tcttaaaaattgtggttaggcctaacacaaccccacacaatcggcttgtgaggtgaggattgcccccacttataaacacattgtcaggccatcacctatc 11036844  T
329 cgatgtgggactcttaaca 347  Q
    |||||| | ||||||||||    
11036845 cgatgttgtactcttaaca 11036863  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #35
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 265 - 347
Target Start/End: Original strand, 27634551 - 27634633
Alignment:
265 aaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggactcttaaca 347  Q
    ||||||||||| |||| ||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||    
27634551 aaaaccggcttgtgaggtgaggattgcccccactcataaacacattgtcaggccatgtcctatccgatgtgggactcttaaca 27634633  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #36
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 229 - 357
Target Start/End: Original strand, 5398475 - 5398603
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    ||||||||||  ||||||| ||||||||||||||| ||||||||||| |||| ||||||||| ||||| ||||||||||||||| ||| |||| | | ||    
5398475 tcttagaaatcatggttggacctaacacaaccccacaaaaccggcttgtgaggtgaggattg-ccccagttataaacacattgttaggccatgacttgtc 5398573  T
329 cgatgtgggactcttaacac-ccccctcac 357  Q
    |||||||||||||||||||| |||||||||    
5398574 cgatgtgggactcttaacacaccccctcac 5398603  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #37
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 231 - 347
Target Start/End: Complemental strand, 5846229 - 5846113
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccg 330  Q
    |||||||| ||||||| ||||||| |||||||| ||||||||||| |||| ||||||||||||||||||||||||| ||||||||  ||  ||||| |||    
5846229 ttagaaatcgtggttgagcctaacgcaaccccacaaaaccggcttatgaggtgaggattgcccccacttataaacaaattgtcagaccaactcctaaccg 5846130  T
331 atgtgggactcttaaca 347  Q
    ||||| |||||||||||    
5846129 atgtgagactcttaaca 5846113  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #38
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 244 - 347
Target Start/End: Original strand, 35645779 - 35645882
Alignment:
244 ttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggactctt 343  Q
    |||||||||||||||||| | ||||| ||||| |||| ||||||||||||||||||||||||||||||||||  |||  ||||| |||||||||||||||    
35645779 ttgggcctaacacaaccctaaaaaactggcttgtgaggtgaggattgcccccacttataaacacattgtcagaccatcacctattcgatgtgggactctt 35645878  T
344 aaca 347  Q
    ||||    
35645879 aaca 35645882  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #39
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 229 - 348
Target Start/End: Original strand, 40717440 - 40717559
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| |||||||||||||||||||||||| ||||||| ||| |||| ||||||||||||||||||||||||| ||| ||||| ||  ||| | |    
40717440 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccgacttttgaggtgaggattgcccccacttataaacaaattatcaggccaactcccaac 40717539  T
329 cgatgtgggactcttaacac 348  Q
     ||||||| |||||||||||    
40717540 tgatgtggaactcttaacac 40717559  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #40
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 229 - 347
Target Start/End: Original strand, 35819127 - 35819245
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    ||||| |||| ||||||||||||||||||||| || ||||| ||||| ||||  ||||||||||||||| |||||||| ||||||||| ||  ||||| |    
35819127 tcttaaaaatcgtggttgggcctaacacaacctcacaaaactggcttgtgaggcgaggattgcccccacatataaacaaattgtcaggccaactcctaac 35819226  T
329 cgatgtgggactcttaaca 347  Q
    |||||||||||||||||||    
35819227 cgatgtgggactcttaaca 35819245  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #41
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 229 - 343
Target Start/End: Original strand, 44118858 - 44118972
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    ||||| |||| ||||| ||  |||||||||||||| ||||| ||||| |||| |||||||| |||||||||||||||||||||||||| ||| || ||||    
44118858 tcttataaatcgtggtgggctctaacacaaccccacaaaacgggcttgtgaggtgaggattacccccacttataaacacattgtcaggccatctcttatc 44118957  T
329 cgatgtgggactctt 343  Q
    |||||||||||||||    
44118958 cgatgtgggactctt 44118972  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #42
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 228 - 357
Target Start/End: Complemental strand, 17111854 - 17111725
Alignment:
228 ctcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctat 327  Q
    ||||||||||| |||||||| |||||||||||| ||||||| |||||| |||  ||| || |  ||||||||||||||||||||||||| |||  |||||    
17111854 ctcttagaaattgtggttggacctaacacaacctcataaaatcggcttttgaagtgatgaataaccccacttataaacacattgtcaggccatcacctat 17111755  T
328 ccgatgtgggactcttaacacccccctcac 357  Q
    | ||||||||||||||||||| | ||||||    
17111754 ctgatgtgggactcttaacacgctcctcac 17111725  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #43
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 228 - 345
Target Start/End: Complemental strand, 35175120 - 35175004
Alignment:
228 ctcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctat 327  Q
    |||||||||||| ||||||||||||||||||||| | |||| || ||| |||| ||| |||| ||||| |||||||||||||||||||| ||||| || |    
35175120 ctcttagaaatg-tggttgggcctaacacaaccctacaaaatcgacttgtgaggtgatgattaccccctcttataaacacattgtcaggccatgttctgt 35175022  T
328 ccgatgtgggactcttaa 345  Q
    ||||||||||||||||||    
35175021 ccgatgtgggactcttaa 35175004  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #44
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 231 - 347
Target Start/End: Original strand, 400566 - 400682
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccg 330  Q
    |||||||| ||||||| || |||||||||| || ||||||||||| |||| |||||||| |||||||||||||||||||||||||  ||| || |||| |    
400566 ttagaaattgtggttgagcttaacacaacctcacaaaaccggcttgtgaggtgaggatttcccccacttataaacacattgtcagaccatctcatatctg 400665  T
331 atgtgggactcttaaca 347  Q
    ||||| |||||||||||    
400666 atgtgagactcttaaca 400682  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #45
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 231 - 347
Target Start/End: Complemental strand, 9685481 - 9685365
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccg 330  Q
    |||||||| ||||||||||||||||||||| || ||||||| ||| |||| ||||||||| ||||||||||||||| ||||| ||| ||  ||||| |||    
9685481 ttagaaatcgtggttgggcctaacacaacctcacaaaaccgacttgtgaggtgaggattggccccacttataaacaaattgttaggccaactcctaaccg 9685382  T
331 atgtgggactcttaaca 347  Q
    |||| ||||||||||||    
9685381 atgtaggactcttaaca 9685365  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #46
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 229 - 316
Target Start/End: Original strand, 34358029 - 34358116
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcagg 316  Q
    |||||||||| ||| ||| |||||||||||||||| |||||||||||||||  ||||||||||||||| |||||||||||||||||||    
34358029 tcttagaaatcgtgtttgagcctaacacaaccccacaaaaccggcttctgatgtgaggattgcccccatttataaacacattgtcagg 34358116  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #47
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 228 - 357
Target Start/End: Original strand, 12869027 - 12869157
Alignment:
228 ctcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctat 327  Q
    ||||||||||| || |||  |||||||||||||||| ||||||||||| |||| ||| ||||||||||||||||||||| ||||||||| ||  | |||     
12869027 ctcttagaaatcgtagtttagcctaacacaaccccacaaaaccggcttgtgaggtgatgattgcccccacttataaacaaattgtcaggccaactgctaa 12869126  T
328 ccgatgtgggactcttaacac-ccccctcac 357  Q
    | ||||| ||||||||||||| |||||||||    
12869127 ctgatgtaggactcttaacacaccccctcac 12869157  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #48
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 246 - 348
Target Start/End: Original strand, 31254423 - 31254525
Alignment:
246 gggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggactcttaa 345  Q
    ||||||||| || || || |||||||| || | || ||||||||||||||||||||||||||||||||||| |||  |||||||||||||||||||||||    
31254423 gggcctaactcatcctcacaaaaccggtttgtaaggtgaggattgcccccacttataaacacattgtcaggccatcacctatccgatgtgggactcttaa 31254522  T
346 cac 348  Q
    |||    
31254523 cac 31254525  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #49
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 231 - 316
Target Start/End: Complemental strand, 2463889 - 2463804
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcagg 316  Q
    ||||||||||||| ||||||||||||||||||| ||||||||||| |||| | ||||||||||||||||||| ||| |||||||||    
2463889 ttagaaatggtggctgggcctaacacaaccccacaaaaccggcttgtgaggtaaggattgcccccacttatacacaaattgtcagg 2463804  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #50
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 229 - 357
Target Start/End: Original strand, 35609489 - 35609618
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| |||||||||  | ||||||||||| ||||||| ||| |||| |||||||||||||||||||||||||| |  | ||| ||| ||| |||    
35609489 tcttagaaatcgtggttgggtgttacacaaccccacaaaaccgacttgtgaggtgaggattgcccccacttataaacacttgtttaggccatctcccatc 35609588  T
329 cgatgtgggactcttaacac-ccccctcac 357  Q
    | |||||||||||||||||| |||||||||    
35609589 caatgtgggactcttaacacaccccctcac 35609618  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #51
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 229 - 353
Target Start/End: Complemental strand, 2516284 - 2516162
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| |||||||| ||||||||||||||| ||||||||||  | || |||| ||||| |||||||||||||| ||||||||||||| | ||| |    
2516284 tcttagaaattgtggttggacctaacacaaccccacaaaaccggctagt-aggtgag-attgctcccacttataaacatattgtcaggtcatcttctaac 2516187  T
329 cgatgtgggactcttaacacccccc 353  Q
    ||| |||||||||||||||| ||||    
2516186 cgaagtgggactcttaacacacccc 2516162  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #52
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 229 - 348
Target Start/End: Original strand, 36685874 - 36685992
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| ||||||||| |||| ||||||||| ||||| | ||| |||| |||||||  |||||| ||||||||||||||||||||||| || |||     
36685874 tcttagaaatcgtggttgggtctaatacaaccccacaaaactgacttgtgaggtgaggataacccccatttataaacacattgtcaggtcatttcatat- 36685972  T
329 cgatgtgggactcttaacac 348  Q
     |||||||||||||||||||    
36685973 tgatgtgggactcttaacac 36685992  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #53
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 229 - 343
Target Start/End: Complemental strand, 6218289 - 6218175
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| ||||||| | |||||||||| ||| ||||||| ||| |||| ||| ||||||||||||||||||||| ||||| | | ||| |||||||    
6218289 tcttagaaatcgtggttgtgtctaacacaactccacaaaaccgtcttgtgaggtgaagattgcccccacttataaacatattgtgaagccatctcctatc 6218190  T
329 cgatgtgggactctt 343  Q
    ||||||| |||||||    
6218189 cgatgtgagactctt 6218175  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #54
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 231 - 341
Target Start/End: Original strand, 53814675 - 53814785
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccg 330  Q
    |||||||| ||||||||||||||||||| |||| ||||||||||| |||| ||||||||  ||||||||||||||| ||||||||| ||  ||||| |||    
53814675 ttagaaatcgtggttgggcctaacacaatcccacaaaaccggcttgtgaggtgaggattatccccacttataaacaaattgtcaggccaactcctagccg 53814774  T
331 atgtgggactc 341  Q
    | || ||||||    
53814775 acgttggactc 53814785  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #55
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 229 - 314
Target Start/End: Original strand, 12869262 - 12869347
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtca 314  Q
    |||||||||| |||||||||||||||||||||||| ||||||| ||| |||| ||||||||| ||||||||||||| | |||||||    
12869262 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccgtcttatgaggtgaggattgtccccacttataaataaattgtca 12869347  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #56
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 231 - 316
Target Start/End: Complemental strand, 16066148 - 16066063
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcagg 316  Q
    |||||||||||||||||||||||||||| || | |||||| | || |||| ||||||||||||||||||||||||| |||||||||    
16066148 ttagaaatggtggttgggcctaacacaatcctacaaaaccagtttgtgaggtgaggattgcccccacttataaacaaattgtcagg 16066063  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #57
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 254 - 343
Target Start/End: Original strand, 27464272 - 27464361
Alignment:
254 cacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggactctt 343  Q
    |||||||||| ||||||||||| |||| ||||||||||| |||||||||||||| ||||||||  || || |||||||||||||||||||    
27464272 cacaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacactttgtcaggaaatctcttatccgatgtgggactctt 27464361  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #58
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 230 - 348
Target Start/End: Original strand, 45784870 - 45784996
Alignment:
230 cttagaaatggtggttgggcctaacacaaccccataaaaccgg--------cttctgagatgaggattgcccccacttataaacacattgtcaggtcatg 321  Q
    ||||||||||||||||||||||||||||||| || ||||||||        ||| |||| ||| ||||||| ||||||||||||| | ||||| |||||     
45784870 cttagaaatggtggttgggcctaacacaacctcacaaaaccggtttgtcggcttgtgaggtgatgattgccgccacttataaacatactgtcaagtcatc 45784969  T
322 tcctatccgatgtgggactcttaacac 348  Q
     ||||||||||||||||||||||||||    
45784970 acctatccgatgtgggactcttaacac 45784996  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #59
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 265 - 353
Target Start/End: Complemental strand, 5846428 - 5846340
Alignment:
265 aaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggactcttaacacccccc 353  Q
    ||||||||||| |||| ||||||||||||||||||||||||| ||||||| | ||  ||||| ||||||||||||||||||||| ||||    
5846428 aaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcatgccaactcctaaccgatgtgggactcttaacacacccc 5846340  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #60
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 282 - 357
Target Start/End: Original strand, 40717258 - 40717334
Alignment:
282 tgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggactcttaacac-ccccctcac 357  Q
    ||||||||| ||||||||||||||||||||||||||||||| || || ||||||||||||||||||| |||||||||    
40717258 tgaggattgtccccacttataaacacattgtcaggtcatgttctgtctgatgtgggactcttaacacaccccctcac 40717334  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #61
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 229 - 353
Target Start/End: Original strand, 18528216 - 18528340
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| ||||||||  |||||||||||| | |||| ||  || |||| ||||||||||| |||||||||||||||||| || | ||| || |||     
18528216 tcttagaaatcgtggttggatctaacacaaccctacaaaatcgatttgtgaggtgaggattgccgccacttataaacacattgccatgccatctcgtatt 18528315  T
329 cgatgtgggactcttaacacccccc 353  Q
     |||||| |||||||||||||||||    
18528316 tgatgtgagactcttaacacccccc 18528340  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #62
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 229 - 356
Target Start/End: Original strand, 25323797 - 25323925
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||| | || |||||| |||||||||||||| ||||||||| |  ||| |||||||||||||||| ||||||||| |  ||||||||| ||  | |    
25323797 tcttagaatttgtagttgggactaacacaaccccacaaaaccggcctgcgaggtgaggattgcccccacgtataaacacttgttcaggtcatctctcaac 25323896  T
329 cgatgtgggactc-ttaacacccccctca 356  Q
    ||||||||| ||| |||||||||||||||    
25323897 cgatgtggggctctttaacacccccctca 25323925  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #63
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 272 - 347
Target Start/End: Original strand, 980092 - 980167
Alignment:
272 gcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggactcttaaca 347  Q
    |||| |||| ||||||||||||||||||||||||| ||| ||||||||  ||||| ||||||||||||||||||||    
980092 gcttgtgaggtgaggattgcccccacttataaacaaattctcaggtcaactcctaaccgatgtgggactcttaaca 980167  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #64
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 229 - 345
Target Start/End: Original strand, 10361998 - 10362116
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtc--aggtcatgtccta 326  Q
    |||||||||| || ||||||||||||| ||||||| || ||| |||| | || ||| |||||| || ||||||||||||| ||||  |||||||||| ||    
10361998 tcttagaaattgtagttgggcctaacataaccccacaataccagcttgtaaggtgatgattgctcctacttataaacacactgtcagaggtcatgtcata 10362097  T
327 tccgatgtgggactcttaa 345  Q
    ||||||||| |||||||||    
10362098 tccgatgtgagactcttaa 10362116  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #65
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 235 - 357
Target Start/End: Original strand, 21750047 - 21750170
Alignment:
235 aaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgt 334  Q
    |||| ||||||| | |||||| ||||||| ||||||||||| |||| |||||| ||| |||||||||||| | |||||||  |||| || ||||||||||    
21750047 aaattgtggttgagtctaacataaccccacaaaaccggcttgtgaggtgaggaatgctcccacttataaagatattgtcatatcatctcttatccgatgt 21750146  T
335 gggactcttaacac-ccccctcac 357  Q
    | |||| ||||||| |||||||||    
21750147 gagacttttaacacaccccctcac 21750170  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #66
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 255 - 314
Target Start/End: Original strand, 28246110 - 28246169
Alignment:
255 acaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtca 314  Q
    ||||||||| ||||||||||| |||| |||||||||||||||||||||||||||||||||    
28246110 acaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacacattgtca 28246169  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #67
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 265 - 347
Target Start/End: Original strand, 13555502 - 13555584
Alignment:
265 aaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggactcttaaca 347  Q
    ||||||||||| |||| |||||||| ||||||||||||| ||||||||||   |||  |||||||||||||||||||||||||    
13555502 aaaaccggcttgtgaggtgaggatttcccccacttataagcacattgtcaaaccatcacctatccgatgtgggactcttaaca 13555584  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #68
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 229 - 311
Target Start/End: Original strand, 28073180 - 28073262
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattg 311  Q
    |||||||||| |||||||||||||||||||||||| |||||| |||| |||| ||||| ||||| |||||| |||| ||||||    
28073180 tcttagaaattgtggttgggcctaacacaaccccacaaaaccagcttgtgaggtgagggttgcctccacttgtaaatacattg 28073262  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #69
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 229 - 307
Target Start/End: Original strand, 35609710 - 35609788
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacac 307  Q
    ||||||||||  |||||||| || ||||||||||| ||||||||||| |||| ||||||||| ||||||||||||||||    
35609710 tcttagaaatcatggttgggtcttacacaaccccacaaaaccggcttgtgaggtgaggattggccccacttataaacac 35609788  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #70
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 229 - 299
Target Start/End: Original strand, 53559289 - 53559359
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccactt 299  Q
    |||||||||| |||||||||||||||||||||||| |||| |||||| | || ||||||||||||||||||    
53559289 tcttagaaatcgtggttgggcctaacacaaccccacaaaatcggcttgtaaggtgaggattgcccccactt 53559359  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #71
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 250 - 343
Target Start/End: Complemental strand, 53699091 - 53698998
Alignment:
250 ctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggactctt 343  Q
    ||||||||||||||||||  ||| || |||| |||||||||||| |||||||||||| |||||||| |||| || ||| || ||||||||||||    
53699091 ctaacacaaccccataaagtcggtttgtgaggtgaggattgcccacacttataaacatattgtcagatcatctcttattcgttgtgggactctt 53698998  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #72
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 270 - 347
Target Start/End: Original strand, 54055072 - 54055149
Alignment:
270 cggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggactcttaaca 347  Q
    |||||| |||||||||||||||||||||||||||||| ||||| ||| ||  | ||| ||||||||||||||||||||    
54055072 cggcttgtgagatgaggattgcccccacttataaacaaattgttaggccaacttctaaccgatgtgggactcttaaca 54055149  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #73
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 229 - 353
Target Start/End: Original strand, 13555246 - 13555370
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    ||||||||||  ||||||||  |||||||| ||||||||||| || | |||| ||||||||||  ||||| ||||| ||| ||||||  |||   |||||    
13555246 tcttagaaatcctggttgggtttaacacaatcccataaaaccagcctgtgaggtgaggattgcatccactcataaatacagtgtcagaccatcatctatc 13555345  T
329 cgatgtgggactcttaacacccccc 353  Q
    |||||||| ||||||||||||||||    
13555346 cgatgtggaactcttaacacccccc 13555370  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #74
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 229 - 301
Target Start/End: Complemental strand, 40726806 - 40726734
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttat 301  Q
    |||||||||| ||||||||||||||||||| || | ||||||||||| |||| |||||||| |||||||||||    
40726806 tcttagaaatcgtggttgggcctaacacaatcctacaaaaccggcttgtgaggtgaggatttcccccacttat 40726734  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #75
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 265 - 347
Target Start/End: Original strand, 6778696 - 6778779
Alignment:
265 aaaaccggcttctgagatgaggattgcccccactt-ataaacacattgtcaggtcatgtcctatccgatgtgggactcttaaca 347  Q
    ||||||||||| |||| ||||||||| | || ||| |||||| |||||||||| |||||| |||||||||||||||||||||||    
6778696 aaaaccggcttgtgaggtgaggattgtctcctctttataaactcattgtcaggccatgtcatatccgatgtgggactcttaaca 6778779  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #76
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 228 - 343
Target Start/End: Complemental strand, 7926644 - 7926529
Alignment:
228 ctcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctat 327  Q
    |||||||||||  ||||||||||||||||||||||| |||| ||||   |  | ||||||||||||||||||| ||||||||  ||||| ||| |  | |    
7926644 ctcttagaaatcatggttgggcctaacacaaccccacaaaatcggcacgtagggtgaggattgcccccacttacaaacacatgttcaggccatcttttgt 7926545  T
328 ccgatgtgggactctt 343  Q
    ||||||||||||||||    
7926544 ccgatgtgggactctt 7926529  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #77
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 241 - 343
Target Start/End: Complemental strand, 7926401 - 7926299
Alignment:
241 tggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggact 340  Q
    ||||||||||||||||| ||||| ||||||||||| ||   |||||| |||||||||||||||||||||  ||||| ||| |  | |||||||||| |||    
7926401 tggttgggcctaacacagccccacaaaaccggcttgtgttgtgaggaatgcccccacttataaacacatgttcaggccatcttttgtccgatgtggaact 7926302  T
341 ctt 343  Q
    |||    
7926301 ctt 7926299  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #78
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 265 - 357
Target Start/End: Original strand, 7806616 - 7806709
Alignment:
265 aaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggactcttaacac-ccccctcac 357  Q
    ||||||||||| |||| ||||||||||| ||||||| ||| ||||||||||| ||  ||||| |||||||||||| ||| |||| |||||||||    
7806616 aaaaccggcttgtgaggtgaggattgccgccacttaaaaatacattgtcaggccaactcctaaccgatgtgggacactttacacaccccctcac 7806709  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #79
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 231 - 348
Target Start/End: Original strand, 11103897 - 11104014
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccg 330  Q
    ||||||||| | ||||| |||||||||| |||| |||||| | || |||  ||||||||| ||| | ||||||| | ||||||||| ||  ||||| |||    
11103897 ttagaaatgatagttggacctaacacaatcccaaaaaaccagtttgtgaagtgaggattgtccctatttataaataaattgtcaggccaactcctaaccg 11103996  T
331 atgtgggactcttaacac 348  Q
    ||||||||||||||||||    
11103997 atgtgggactcttaacac 11104014  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #80
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 231 - 335
Target Start/End: Complemental strand, 26549720 - 26549615
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgc-ccccacttataaacacattgtcaggtcatgtcctatcc 329  Q
    ||||||||  || |||| ||| ||||||| ||| ||||||||||| |||||| |||||| | |||||||||||||||||| |||||| ||| || |||||    
26549720 ttagaaatcatgattggacctgacacaacaccacaaaaccggcttgtgagataaggattactccccacttataaacacatcgtcaggccatctcttatcc 26549621  T
330 gatgtg 335  Q
    ||||||    
26549620 gatgtg 26549615  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #81
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 240 - 297
Target Start/End: Original strand, 35645696 - 35645753
Alignment:
240 gtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccac 297  Q
    |||||||||| |||||||||| ||||||||||||||||||| ||| ||||||||||||    
35645696 gtggttgggcttaacacaacctcataaaaccggcttctgaggtgatgattgcccccac 35645753  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #82
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 243 - 343
Target Start/End: Original strand, 12005482 - 12005582
Alignment:
243 gttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggactct 342  Q
    |||||| ||||||||||| || ||||||||||| |||| |||||||||||||||||||| |||| ||  ||| | ||| |  | ||||||||||||||||    
12005482 gttgggtctaacacaacctcacaaaaccggcttgtgaggtgaggattgcccccacttattaacaaatgttcatgccatattttgtccgatgtgggactct 12005581  T
343 t 343  Q
    |    
12005582 t 12005582  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #83
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 229 - 305
Target Start/End: Complemental strand, 17111648 - 17111573
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaac 305  Q
    |||||||||| |||||||||||||||||||||||| |||||| | || | || ||||||||| ||||||||||||||    
17111648 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccagtttttaaggtgaggattg-ccccacttataaac 17111573  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #84
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 229 - 347
Target Start/End: Complemental strand, 22445537 - 22445415
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgc-ccccacttataaacacat---tgtcaggtcatgtcc 324  Q
    |||||||| | ||||||||| |||||||||||||| ||||||| ||| |  | |||||||||| ||||||| ||||||||||   |||||| |||| |||    
22445537 tcttagaatttgtggttgggtctaacacaaccccacaaaaccgacttgtagggtgaggattgccccccactaataaacacattaatgtcagatcatctcc 22445438  T
325 tatccgatgtgggactcttaaca 347  Q
    |||| ||| || |||||||||||    
22445437 tatcagatatgagactcttaaca 22445415  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #85
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 240 - 344
Target Start/End: Original strand, 30566044 - 30566148
Alignment:
240 gtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggac 339  Q
    |||||||||| |||||||| || | ||||| ||||| |||  |||| ||||| |||||||||||||||||||||||||| | |||| |  |||||| |||    
30566044 gtggttgggcttaacacaaacctacaaaactggcttatgatgtgagaattgctcccacttataaacacattgtcaggtcttctcctgtttgatgtgtgac 30566143  T
340 tctta 344  Q
    |||||    
30566144 tctta 30566148  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #86
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 231 - 346
Target Start/End: Original strand, 2261754 - 2261869
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccg 330  Q
    ||||||||||||||||  | ||||||||||||| ||||| ||  | |||| ||||||||| ||||||||||||| | ||||||||| ||  ||||| ||     
2261754 ttagaaatggtggttgaacttaacacaaccccacaaaactggtctgtgaggtgaggattgtccccacttataaataaattgtcaggccacctcctaacca 2261853  T
331 atgtgggactcttaac 346  Q
    ||||| |||| |||||    
2261854 atgtgagacttttaac 2261869  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #87
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 229 - 308
Target Start/End: Complemental strand, 22822435 - 22822356
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacaca 308  Q
    |||||||| | |||||||| ||||| |||||| || ||||||||||| || | |||||||| ||||||||||||||||||    
22822435 tcttagaatttgtggttggacctaatacaaccgcacaaaaccggcttgtgtggtgaggatttcccccacttataaacaca 22822356  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #88
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 231 - 302
Target Start/End: Original strand, 24513361 - 24513431
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttata 302  Q
    |||||||| ||| |||||||||||||||||| | ||| ||||||| |||| |||||||||||||||||||||    
24513361 ttagaaatcgtgattgggcctaacacaaccctacaaa-ccggcttgtgaggtgaggattgcccccacttata 24513431  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #89
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 228 - 315
Target Start/End: Original strand, 41187930 - 41188017
Alignment:
228 ctcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcag 315  Q
    ||||||||||| |||||||||| |||| |||||||| ||||||  ||| |||| |||||||||||   ||||||||| ||||||||||    
41187930 ctcttagaaatcgtggttgggcataactcaaccccacaaaaccaacttgtgaggtgaggattgcctttacttataaatacattgtcag 41188017  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #90
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 249 - 348
Target Start/End: Complemental strand, 42662528 - 42662429
Alignment:
249 cctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggactcttaacac 348  Q
    ||||| |||| |||| |||||||| || ||||||||| |||  ||| | ||||||||||||||||||  ||| |||||| |||||||||| |||||||||    
42662528 cctaatacaatcccacaaaaccggtttgtgagatgagaattatccctatttataaacacattgtcagaccatctcctattcgatgtgggattcttaacac 42662429  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #91
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 229 - 299
Target Start/End: Original strand, 6666634 - 6666704
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccactt 299  Q
    |||||||||| |||||||||||||| |||| |||| |||||||| || |||| | ||||||||||||||||    
6666634 tcttagaaatcgtggttgggcctaaaacaatcccacaaaaccggtttgtgaggtaaggattgcccccactt 6666704  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #92
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 249 - 347
Target Start/End: Original strand, 11783811 - 11783909
Alignment:
249 cctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggactcttaaca 347  Q
    ||||||||||||||| ||||||   || |||| |||||||| |||| ||||||||||| ||||| | ||||| | |||| ||||||| |||||||||||    
11783811 cctaacacaaccccacaaaaccaatttgtgaggtgaggattacccctacttataaacaaattgtaaagtcattttctattcgatgtgagactcttaaca 11783909  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #93
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 229 - 315
Target Start/End: Original strand, 21646500 - 21646586
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcag 315  Q
    ||||| |||| |||||||||||||| | | ||||||||||||| ||| | || ||||||||| ||| |||| |||||||||||||||    
21646500 tcttaaaaatcgtggttgggcctaatagagccccataaaaccgacttgtaaggtgaggattgtccctacttgtaaacacattgtcag 21646586  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #94
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 229 - 307
Target Start/End: Original strand, 50870480 - 50870557
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacac 307  Q
    |||||||||| |||||||| ||||||||||||||| |||| |||| |  ||| |||||| |||||||||||||||||||    
50870480 tcttagaaattgtggttggacctaacacaaccccacaaaatcggc-taagaggtgaggactgcccccacttataaacac 50870557  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #95
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 231 - 336
Target Start/End: Complemental strand, 13637472 - 13637367
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccg 330  Q
    |||||||| ||||||||| || | ||||||||| ||||||   || |||  ||| ||||||||| ||||||||||||||||||| ||||| || ||| ||    
13637472 ttagaaatcgtggttgggtcttagacaaccccacaaaaccaaattgtgaagtgaagattgcccctacttataaacacattgtcaagtcatctcttattcg 13637373  T
331 atgtgg 336  Q
    ||||||    
13637372 atgtgg 13637367  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #96
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 240 - 297
Target Start/End: Original strand, 35645407 - 35645464
Alignment:
240 gtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccac 297  Q
    |||||||||| |||||||||| |||||||| |||||||||| ||| ||||||||||||    
35645407 gtggttgggcttaacacaacctcataaaactggcttctgaggtgatgattgcccccac 35645464  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #97
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 298 - 357
Target Start/End: Original strand, 6778511 - 6778571
Alignment:
298 ttataaacacattgtcaggtcatgtcctatccgatgtgggactcttaacac-ccccctcac 357  Q
    ||||||| | ||||||||  ||||||||||||||||||||||||||||||| |||||||||    
6778511 ttataaatatattgtcagaccatgtcctatccgatgtgggactcttaacacaccccctcac 6778571  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #98
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 241 - 309
Target Start/End: Original strand, 30529937 - 30530005
Alignment:
241 tggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacat 309  Q
    |||||| ||||||||||| | |||||||||||||| |||| |||| ||| |||| ||||||||||||||    
30529937 tggttgagcctaacacaatctcataaaaccggcttgtgaggtgagaattaccccaacttataaacacat 30530005  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #99
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 246 - 305
Target Start/End: Original strand, 17222668 - 17222727
Alignment:
246 gggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaac 305  Q
    |||||||||||| ||  | ||||||||||| |||| ||||||||||||||||||||||||    
17222668 gggcctaacacatccttacaaaaccggcttgtgaggtgaggattgcccccacttataaac 17222727  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #100
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 231 - 302
Target Start/End: Original strand, 24513140 - 24513211
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttata 302  Q
    ||||||||  |||||| ||||||||||| |||| ||||| |||||||||| ||||||||||||  |||||||    
24513140 ttagaaatcatggttgcgcctaacacaatcccacaaaactggcttctgaggtgaggattgcccatacttata 24513211  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #101
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 228 - 307
Target Start/End: Original strand, 42684791 - 42684870
Alignment:
228 ctcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacac 307  Q
    ||||||||| | ||| ||| ||||||| |||| ||| ||||||||||| |||| ||| ||||||||||| ||||||||||    
42684791 ctcttagaacttgtgcttgagcctaactcaacgccacaaaaccggcttgtgaggtgatgattgcccccatttataaacac 42684870  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #102
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 257 - 315
Target Start/End: Complemental strand, 7892605 - 7892547
Alignment:
257 aaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcag 315  Q
    ||||||| |||||||| || ||||||||  |||||| ||||||||||||||||||||||    
7892605 aaccccacaaaaccggattgtgagatgaaaattgcctccacttataaacacattgtcag 7892547  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #103
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 229 - 347
Target Start/End: Original strand, 18528456 - 18528574
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| ||||||||| |||||| || | || |||||||  || |||| ||||||||||||||| || | ||||||||||||    || |||| ||    
18528456 tcttagaaatcgtggttgggtctaacaaaatctcacaaaaccgatttgtgaggtgaggattgcccccaattgttaacacattgtcacactatctcctgtc 18528555  T
329 cgatgtgggactcttaaca 347  Q
    ||||||| |||| ||||||    
18528556 cgatgtgagacttttaaca 18528574  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #104
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 243 - 309
Target Start/End: Complemental strand, 35485298 - 35485232
Alignment:
243 gttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacat 309  Q
    |||||| |||||||||||||| |||||| || | | || |||||| |||||||||||||||||||||    
35485298 gttgggtctaacacaaccccacaaaaccagcgtgtaaggtgaggactgcccccacttataaacacat 35485232  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #105
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 250 - 307
Target Start/End: Original strand, 6666220 - 6666277
Alignment:
250 ctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacac 307  Q
    |||||||||||||| |||||| | || |||| ||||||||||||||| ||||||||||    
6666220 ctaacacaaccccacaaaacctgtttgtgaggtgaggattgcccccaattataaacac 6666277  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #106
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 265 - 309
Target Start/End: Original strand, 2221003 - 2221047
Alignment:
265 aaaaccggcttctgagatgaggattgcccccacttataaacacat 309  Q
    ||||||||||| |||| |||||||||||||||| |||||||||||    
2221003 aaaaccggcttgtgaggtgaggattgcccccacctataaacacat 2221047  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #107
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 229 - 309
Target Start/End: Original strand, 21646264 - 21646344
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacat 309  Q
    ||||| |||| |||||| || ||||||||||  || ||||| ||||| | || ||||||||||||||| ||||||||||||    
21646264 tcttaaaaattgtggttaggtctaacacaacatcacaaaactggcttgtaaggtgaggattgcccccatttataaacacat 21646344  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #108
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 229 - 305
Target Start/End: Complemental strand, 43743074 - 43742998
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaac 305  Q
    ||||| |||| |||||| || |||||| ||||||| ||||| ||||| |||| |||||||| | |||||||||||||    
43743074 tcttataaatcgtggttaggtctaacataaccccaaaaaactggcttgtgagttgaggattactcccacttataaac 43742998  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #109
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 229 - 315
Target Start/End: Complemental strand, 4464380 - 4464291
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctga---gatgaggattgcccccacttataaacacattgtcag 315  Q
    |||||||| | ||||||||| |||||| ||||||| |||| |||||| |||   | ||||| ||||||| | ||||||||||||||||||    
4464380 tcttagaattcgtggttgggtctaacaaaaccccacaaaatcggcttgtgatccggtgagggttgcccctatttataaacacattgtcag 4464291  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #110
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 282 - 341
Target Start/End: Original strand, 32333962 - 32334021
Alignment:
282 tgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggactc 341  Q
    ||||||||| ||||||||||||||||||  ||||||||| || ||||| ||||| |||||    
32333962 tgaggattgtccccacttataaacacatgttcaggtcatctcttatccaatgtgcgactc 32334021  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #111
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 229 - 307
Target Start/End: Original strand, 50828207 - 50828285
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacac 307  Q
    |||||||| | ||| |||||||||||||| ||||| ||||||||| | |||| ||| || | | |||||||||||||||    
50828207 tcttagaatttgtgtttgggcctaacacagccccacaaaaccggcctgtgaggtgatgactactcccacttataaacac 50828285  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #112
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 244 - 309
Target Start/End: Original strand, 20726838 - 20726903
Alignment:
244 ttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacat 309  Q
    ||||||||||| || ||  ||||||| | |||  ||| ||||||||||||||||||||||||||||    
20726838 ttgggcctaactcatccttataaaactgactttggaggtgaggattgcccccacttataaacacat 20726903  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #113
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 228 - 305
Target Start/End: Original strand, 31039345 - 31039416
Alignment:
228 ctcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaac 305  Q
    ||||||||||| |||||||| ||||||||||| ||| ||||||| |||      ||||||||||||||||||||||||    
31039345 ctcttagaaattgtggttgg-cctaacacaactccacaaaaccgactt-----gtgaggattgcccccacttataaac 31039416  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #114
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 240 - 344
Target Start/End: Original strand, 13611759 - 13611863
Alignment:
240 gtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggac 339  Q
    |||||||| | |||| |||||||  ||||||  ||| |||| ||||||||  ||||||||||||| | ||||||||  |||  ||||||| |||||| ||    
13611759 gtggttggtcttaactcaaccccgcaaaaccaccttgtgaggtgaggattatccccacttataaatatattgtcagaccatcacctatccaatgtggaac 13611858  T
340 tctta 344  Q
    |||||    
13611859 tctta 13611863  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #115
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 241 - 340
Target Start/End: Complemental strand, 20253584 - 20253484
Alignment:
241 tggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcagg-tcatgtcctatccgatgtgggac 339  Q
    ||||||| ||||||||| ||||| |||| | || | |||| ||| | |||   ||||||||||||||||||||||| |||| || ||||||||||| |||    
20253584 tggttggacctaacacagccccacaaaatcagcatgtgaggtgatggttgttgccacttataaacacattgtcaggatcatctcttatccgatgtgagac 20253485  T
340 t 340  Q
    |    
20253484 t 20253484  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #116
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 229 - 309
Target Start/End: Complemental strand, 21041436 - 21041356
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacat 309  Q
    |||||||| | ||||||| |||||||| |||  |  |||||||| || |||| ||||||||  ||||||||||||||||||    
21041436 tcttagaatttgtggttgtgcctaacataacttcgcaaaaccggtttgtgaggtgaggattttccccacttataaacacat 21041356  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #117
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 253 - 293
Target Start/End: Original strand, 52146088 - 52146128
Alignment:
253 acacaaccccataaaaccggcttctgagatgaggattgccc 293  Q
    ||||||||||| ||||||||||| |||| ||||||||||||    
52146088 acacaaccccacaaaaccggcttgtgaggtgaggattgccc 52146128  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #118
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 250 - 306
Target Start/End: Complemental strand, 53698858 - 53698802
Alignment:
250 ctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaaca 306  Q
    ||||||||| || | ||||||||||| |||||||| |||||||| || |||||||||    
53698858 ctaacacaatcctacaaaaccggcttgtgagatgacgattgccctcatttataaaca 53698802  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 103; Significance: 4e-51; HSPs: 89)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 103; E-Value: 4e-51
Query Start/End: Original strand, 228 - 361
Target Start/End: Original strand, 17147658 - 17147792
Alignment:
228 ctcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctat 327  Q
    |||||||||||||||||||| ||||||| ||||||| ||||||||||| |||| ||||||||||||||||||||||| ||||||||||||||||||||||    
17147658 ctcttagaaatggtggttggacctaacataaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaatacattgtcaggtcatgtcctat 17147757  T
328 ccgatgtgggactcttaacac-ccccctcacaacc 361  Q
    ||||||||||||||||||||| |||||||||||||    
17147758 ccgatgtgggactcttaacacaccccctcacaacc 17147792  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 229 - 357
Target Start/End: Original strand, 4868576 - 4868705
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| |||||||||||||||||||||||| ||||||||||| |||| ||||||||||||||||||||||||||||||||||| |||||||| ||    
4868576 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacacattgtcaggccatgtcctgtc 4868675  T
329 cgatgtgggactcttaacac-ccccctcac 357  Q
    |||||||||||||||||||| |||||||||    
4868676 cgatgtgggactcttaacacaccccctcac 4868705  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 229 - 347
Target Start/End: Complemental strand, 13353286 - 13353168
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    ||||||||||||||||||||||||||||||||||| ||||||||||| | || ||||||||||||||||||||||||||||||||||| |||||||| ||    
13353286 tcttagaaatggtggttgggcctaacacaaccccacaaaaccggcttgtaaggtgaggattgcccccacttataaacacattgtcaggccatgtcctgtc 13353187  T
329 cgatgtgggactcttaaca 347  Q
    |||||||||||||||||||    
13353186 cgatgtgggactcttaaca 13353168  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 229 - 347
Target Start/End: Complemental strand, 33796411 - 33796293
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    ||||||||||||||||||||||||||||||||||| ||||||||||| | || ||||||||||||||||||||||||||||||||||| |||||||| ||    
33796411 tcttagaaatggtggttgggcctaacacaaccccacaaaaccggcttgtaaggtgaggattgcccccacttataaacacattgtcaggccatgtcctgtc 33796312  T
329 cgatgtgggactcttaaca 347  Q
    |||||||||||||||||||    
33796311 cgatgtgggactcttaaca 33796293  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 91; E-Value: 5e-44
Query Start/End: Original strand, 229 - 347
Target Start/End: Original strand, 4868812 - 4868930
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| |||||||||||||||||||||||| ||||||||||| |||| |||||||||||||||||||||||||||||| |||| |||||||| ||    
4868812 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacacattgccaggccatgtcctgtc 4868911  T
329 cgatgtgggactcttaaca 347  Q
    |||||||||||||||||||    
4868912 cgatgtgggactcttaaca 4868930  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 91; E-Value: 5e-44
Query Start/End: Original strand, 228 - 357
Target Start/End: Complemental strand, 9705340 - 9705210
Alignment:
228 ctcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctat 327  Q
    ||||||||||| ||||||||| |||||||||||||| ||||||||||| |||| ||||||||||||||||||||||||||||||| | | ||||||||||    
9705340 ctcttagaaatcgtggttgggtctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacacattgttaagccatgtcctat 9705241  T
328 ccgatgtgggactcttaacac-ccccctcac 357  Q
    ||||||||||||||||||||| |||||||||    
9705240 ccgatgtgggactcttaacacaccccctcac 9705210  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 229 - 347
Target Start/End: Complemental strand, 9705105 - 9704987
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    ||||||||||||||||||||||||||||||||||| ||||||| ||| |||| ||| |||||||||||||||||||||||||||||||  ||||||||||    
9705105 tcttagaaatggtggttgggcctaacacaaccccacaaaaccgacttgtgaggtgatgattgcccccacttataaacacattgtcaggctatgtcctatc 9705006  T
329 cgatgtgggactcttaaca 347  Q
    ||||||| |||||||||||    
9705005 cgatgtgagactcttaaca 9704987  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 231 - 357
Target Start/End: Complemental strand, 27656541 - 27656415
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccg 330  Q
    |||||||| |||||||||||||||||||||||| ||||||||||| |||| |||||||| |||||||||||||||| ||||||||| ||  ||||| |||    
27656541 ttagaaattgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggatttcccccacttataaacaaattgtcaggccaactcctaaccg 27656442  T
331 atgtgggactcttaacacccccctcac 357  Q
    |||||||||||||||||||||||||||    
27656441 atgtgggactcttaacacccccctcac 27656415  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 229 - 347
Target Start/End: Complemental strand, 33494624 - 33494506
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    ||||||||||||||||||||||||||||||||||| ||||||||||| |||| ||||||||||||||||||||||||| ||| ||| | ||| |||||||    
33494624 tcttagaaatggtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacatattttcaagccatctcctatc 33494525  T
329 cgatgtgggactcttaaca 347  Q
    |||||||||||||||||||    
33494524 cgatgtgggactcttaaca 33494506  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 231 - 347
Target Start/End: Original strand, 12330292 - 12330407
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccg 330  Q
    |||||||| ||||||||||||||||||||| || ||||||||||| |||||||||||||| ||||||||||||||||||||||||  |||||||||||||    
12330292 ttagaaatcgtggttgggcctaacacaacctcacaaaaccggcttgtgagatgaggattg-ccccacttataaacacattgtcagaccatgtcctatccg 12330390  T
331 atgtgggactcttaaca 347  Q
    |||||||||||||||||    
12330391 atgtgggactcttaaca 12330407  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 81; E-Value: 5e-38
Query Start/End: Original strand, 229 - 345
Target Start/End: Original strand, 25065093 - 25065209
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| || ||||||||||||||||||||| ||||||||||| |||| ||||||||||||| ||||||||||| ||||||||  |||||||||||    
25065093 tcttagaaatcgtagttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccctacttataaacatattgtcagaccatgtcctatc 25065192  T
329 cgatgtgggactcttaa 345  Q
    |||||||||||||||||    
25065193 cgatgtgggactcttaa 25065209  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #12
Raw Score: 79; E-Value: 8e-37
Query Start/End: Original strand, 231 - 345
Target Start/End: Complemental strand, 30256895 - 30256782
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccg 330  Q
    |||||||| |||||||||||||||||||||||| ||||||||||| |||| ||||||||| ||||||||||||||| |||||||||||||  ||||||||    
30256895 ttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattg-ccccacttataaacatattgtcaggtcatcacctatccg 30256797  T
331 atgtgggactcttaa 345  Q
    |||||||||||||||    
30256796 atgtgggactcttaa 30256782  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #13
Raw Score: 76; E-Value: 5e-35
Query Start/End: Original strand, 229 - 348
Target Start/End: Complemental strand, 19713037 - 19712918
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||||||||||||||||||||||| |||| ||||||||||| |||| |||| |||||||||||||||||||| ||||||||| ||  ||||| |    
19713037 tcttagaaatggtggttgggcctaacacaatcccacaaaaccggcttgtgaggtgagaattgcccccacttataaacaaattgtcaggccaactcctaac 19712938  T
329 cgatgtgggactcttaacac 348  Q
    |||||||| |||||||||||    
19712937 cgatgtggaactcttaacac 19712918  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #14
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 229 - 347
Target Start/End: Original strand, 6542942 - 6543060
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||| ||||| ||||||||| |||||||||||||| |||||||||||||||| ||| ||||||||||||||||||||||||||||||  ||| || ||||    
6542942 tctttgaaatcgtggttgggtctaacacaaccccacaaaaccggcttctgaggtgatgattgcccccacttataaacacattgtcagaccatctcttatc 6543041  T
329 cgatgtgggactcttaaca 347  Q
    |||||||| ||||||||||    
6543042 cgatgtggaactcttaaca 6543060  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #15
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 231 - 349
Target Start/End: Complemental strand, 8026472 - 8026354
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccg 330  Q
    |||||||| |||||||||||||||||||||||| ||||||||||| |||| ||||||||||||||||||||||||| ||||||||| ||  || || |||    
8026472 ttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcaggccaactcataaccg 8026373  T
331 atgtgggactcttaacacc 349  Q
    | |||||||||||||||||    
8026372 acgtgggactcttaacacc 8026354  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #16
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 231 - 349
Target Start/End: Complemental strand, 21690805 - 21690687
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccg 330  Q
    |||||||| ||||||| |||||||||||||||| |||| |||||| |||| ||||||||||||||||||||||||| ||||||||| ||  ||||| |||    
21690805 ttagaaatcgtggttgagcctaacacaaccccacaaaatcggcttgtgaggtgaggattgcccccacttataaacaaattgtcaggccaaatcctaaccg 21690706  T
331 atgtgggactcttaacacc 349  Q
    |||||||||||||||||||    
21690705 atgtgggactcttaacacc 21690687  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #17
Raw Score: 74; E-Value: 7e-34
Query Start/End: Original strand, 231 - 340
Target Start/End: Original strand, 12330180 - 12330289
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccg 330  Q
    |||||||| ||||||||||||||||||||| || ||||||||||| |||| ||||| ||||||||||||||||||||||||||||  |||||||||||||    
12330180 ttagaaatcgtggttgggcctaacacaacctcacaaaaccggcttgtgaggtgagggttgcccccacttataaacacattgtcagaccatgtcctatccg 12330279  T
331 atgtgggact 340  Q
    || |||||||    
12330280 atctgggact 12330289  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #18
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 240 - 353
Target Start/End: Original strand, 6400630 - 6400743
Alignment:
240 gtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggac 339  Q
    ||||||||| |||||||||||||| ||||||| ||| |||  ||||||||||| ||||||||||||||||||||||| |||||| | ||||||||| |||    
6400630 gtggttgggtctaacacaaccccacaaaaccgacttgtgatgtgaggattgcctccacttataaacacattgtcaggccatgtcatgtccgatgtgagac 6400729  T
340 tcttaacacccccc 353  Q
    ||||||||||||||    
6400730 tcttaacacccccc 6400743  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #19
Raw Score: 69; E-Value: 7e-31
Query Start/End: Original strand, 231 - 347
Target Start/End: Complemental strand, 27653300 - 27653184
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccg 330  Q
    |||||||| ||||||||||||||||||| |||| ||||||| ||| |||| |||||||| |||||||||||||||| ||||||||| ||  ||||| |||    
27653300 ttagaaatcgtggttgggcctaacacaatcccacaaaaccgacttgtgaggtgaggatttcccccacttataaacaaattgtcaggccaactcctaaccg 27653201  T
331 atgtgggactcttaaca 347  Q
    |||||||||||||||||    
27653200 atgtgggactcttaaca 27653184  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #20
Raw Score: 69; E-Value: 7e-31
Query Start/End: Original strand, 231 - 347
Target Start/End: Complemental strand, 27772797 - 27772681
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccg 330  Q
    |||||||| |||||||| ||||||||||| ||| ||||||||||| |||| ||||||||||||||||||||||||| ||||||||| ||  ||||| |||    
27772797 ttagaaatcgtggttggacctaacacaactccacaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcaggccaactcctaaccg 27772698  T
331 atgtgggactcttaaca 347  Q
    |||||||| ||||||||    
27772697 atgtgggaatcttaaca 27772681  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #21
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 235 - 357
Target Start/End: Original strand, 12329949 - 12330072
Alignment:
235 aaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgt 334  Q
    |||| ||||||||||||||||||||| || |||| | |||| |||| ||||||||||||||||||||||||||||||| |  |||| || ||||||||||    
12329949 aaatcgtggttgggcctaacacaacctcacaaaatcagcttgtgaggtgaggattgcccccacttataaacacattgttatatcatatcttatccgatgt 12330048  T
335 gggactcttaacac-ccccctcac 357  Q
    |||||||||||||| |||||||||    
12330049 gggactcttaacacaccccctcac 12330072  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #22
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 241 - 347
Target Start/End: Complemental strand, 2753331 - 2753225
Alignment:
241 tggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggact 340  Q
    ||||||||||||||||||||||| ||||||| ||| |||| |||||||| ||||||||||||||||||||||||| ||||   || ||||||||||||||    
2753331 tggttgggcctaacacaaccccacaaaaccgccttgtgaggtgaggattacccccacttataaacacattgtcagatcatcatctttccgatgtgggact 2753232  T
341 cttaaca 347  Q
    |||||||    
2753231 cttaaca 2753225  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #23
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 245 - 347
Target Start/End: Original strand, 28867972 - 28868074
Alignment:
245 tgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggactctta 344  Q
    ||||||||||||||||||| ||||||||||| |||| ||||||||||||||||||||||| | ||||||||||||  || || |||||||||||||||||    
28867972 tgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaataaattgtcaggtcaactcgtaaccgatgtgggactctta 28868071  T
345 aca 347  Q
    |||    
28868072 aca 28868074  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #24
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 230 - 348
Target Start/End: Complemental strand, 30256662 - 30256544
Alignment:
230 cttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatcc 329  Q
    ||||||||| |||||||||||||||||||||||| |||||||| || |||| ||||||||||||||| |||||||||||||||||   |||||  | |||    
30256662 cttagaaatcgtggttgggcctaacacaaccccacaaaaccggtttgtgagttgaggattgcccccagttataaacacattgtcaaaccatgtattgtcc 30256563  T
330 gatgtgggactcttaacac 348  Q
    |||||| ||||||||||||    
30256562 gatgtgagactcttaacac 30256544  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #25
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 229 - 357
Target Start/End: Original strand, 2736166 - 2736295
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| ||||||||| ||||||||| || | |||| | | || |||| ||||||||| ||||||||||||||||||||||||||||| ||||| |    
2736166 tcttagaaatcgtggttgggtctaacacaatcctacaaaatctgtttatgaggtgaggattgtccccacttataaacacattgtcaggtcatctcctacc 2736265  T
329 cgatgtgggactcttaacac-ccccctcac 357  Q
    |||||||||||||| ||||| |||||||||    
2736266 cgatgtgggactctcaacacaccccctcac 2736295  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #26
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 231 - 348
Target Start/End: Complemental strand, 27773029 - 27772912
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccg 330  Q
    ||||||||  ||||||||| |||||||| |||| |||||| |||| |||| ||||||||||||||||||||||||| ||||||||| ||  ||||| |||    
27773029 ttagaaattatggttgggcttaacacaatcccacaaaaccagcttgtgaggtgaggattgcccccacttataaacaaattgtcaggccaactcctaaccg 27772930  T
331 atgtgggactcttaacac 348  Q
    ||||||||||||||||||    
27772929 atgtgggactcttaacac 27772912  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #27
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 231 - 347
Target Start/End: Original strand, 8566960 - 8567075
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccg 330  Q
    |||||||| |||||||||||||||||||||||| |||||||| || |||| |||||||||  |||||||||||||||||||||||  |||  ||||||||    
8566960 ttagaaatcgtggttgggcctaacacaaccccacaaaaccggtttgtgaggtgaggattg-tcccacttataaacacattgtcagaccatcacctatccg 8567058  T
331 atgtgggactcttaaca 347  Q
    | |||||||||||||||    
8567059 aggtgggactcttaaca 8567075  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #28
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 229 - 312
Target Start/End: Complemental strand, 11721990 - 11721907
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgt 312  Q
    |||||||||| |||||||||||||||||||||||| ||||||||||| |||| ||||||||||||||||||||||||| |||||    
11721990 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttatgaggtgaggattgcccccacttataaacaaattgt 11721907  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #29
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 229 - 348
Target Start/End: Original strand, 19639112 - 19639231
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| |||||||| ||||||||| |||||  ||||||| || |||| ||||||||| ||||||||||||||||||||||||| ||| || ||||    
19639112 tcttagaaatcgtggttggacctaacacagccccactaaaccggtttgtgaggtgaggattgtccccacttataaacacattgtcaggccatatcttatc 19639211  T
329 cgatgtgggactcttaacac 348  Q
    | |||||||| |||||||||    
19639212 ctatgtgggattcttaacac 19639231  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #30
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 227 - 353
Target Start/End: Complemental strand, 6054490 - 6054364
Alignment:
227 tctcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtccta 326  Q
    |||||||||||| ||||||||| |||||||||||| | |||| ||| || |||| ||||||||||||||||||||||| || |||||||  ||| || ||    
6054490 tctcttagaaatcgtggttgggtctaacacaaccctacaaaatcggtttgtgaggtgaggattgcccccacttataaataccttgtcagaccatctctta 6054391  T
327 tccgatgtgggactcttaacacccccc 353  Q
    |||||||| ||||||||||||| ||||    
6054390 tccgatgttggactcttaacacacccc 6054364  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #31
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 227 - 345
Target Start/End: Complemental strand, 13741003 - 13740885
Alignment:
227 tctcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtccta 326  Q
    |||||||||||| |||||||||||||||||||||||| ||||||| ||| |||  |||||||||| |||||||||||||| ||||||||| ||   | ||    
13741003 tctcttagaaattgtggttgggcctaacacaaccccacaaaaccgacttgtgaagtgaggattgctcccacttataaacaaattgtcaggccaacacata 13740904  T
327 tccgatgtgggactcttaa 345  Q
    |||||||||| ||||||||    
13740903 tccgatgtggaactcttaa 13740885  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #32
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 227 - 345
Target Start/End: Complemental strand, 13746503 - 13746385
Alignment:
227 tctcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtccta 326  Q
    |||||||||||| |||||||||||||||||||||||| ||||||| ||| |||  |||||||||| |||||||||||||| ||||||||| ||   | ||    
13746503 tctcttagaaattgtggttgggcctaacacaaccccacaaaaccgacttgtgaagtgaggattgctcccacttataaacaaattgtcaggccaacacata 13746404  T
327 tccgatgtgggactcttaa 345  Q
    |||||||||| ||||||||    
13746403 tccgatgtggaactcttaa 13746385  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #33
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 232 - 357
Target Start/End: Original strand, 5572386 - 5572511
Alignment:
232 tagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccga 331  Q
    ||||||| |||||||||||||||||||||||| ||||||| ||| |||| ||||||| ||||| ||||||||||| |||||||||  |  ||||| ||||    
5572386 tagaaatcgtggttgggcctaacacaaccccacaaaaccgacttgtgaggtgaggatggccccaacttataaacaaattgtcaggcaaactcctaaccga 5572485  T
332 tgtgggactcttaacacccccctcac 357  Q
    |||| |||| ||||||| ||||||||    
5572486 tgtgagacttttaacacacccctcac 5572511  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #34
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 231 - 348
Target Start/End: Original strand, 15081909 - 15082026
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccg 330  Q
    |||||||| ||| ||||||||||||||| |||| ||||||||||| |||| | |||||||||||||||| |||||| ||||||||  ||| ||||| |||    
15081909 ttagaaatcgtgtttgggcctaacacaatcccacaaaaccggcttgtgagttaaggattgcccccacttgtaaacatattgtcagtccatctcctaaccg 15082008  T
331 atgtgggactcttaacac 348  Q
     |||||||||||||||||    
15082009 ttgtgggactcttaacac 15082026  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #35
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 231 - 347
Target Start/End: Complemental strand, 24554200 - 24554084
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccg 330  Q
    ||||||||  |||||| | |||||||||| ||| ||||||||||| |||| ||| ||||||||||||||||||| | ||||||||  ||| |||||||||    
24554200 ttagaaattatggttgagactaacacaactccacaaaaccggcttgtgaggtgaagattgcccccacttataaatatattgtcagaccatctcctatccg 24554101  T
331 atgtgggactcttaaca 347  Q
    |||||||||||||||||    
24554100 atgtgggactcttaaca 24554084  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #36
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 229 - 315
Target Start/End: Complemental strand, 3680097 - 3680011
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcag 315  Q
    |||||||||| |||||||||||||||||||||||| |||| || ||| ||||| |||||||||||||| ||||||||||||||||||    
3680097 tcttagaaattgtggttgggcctaacacaaccccacaaaatcgacttgtgagaggaggattgcccccagttataaacacattgtcag 3680011  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #37
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 258 - 347
Target Start/End: Original strand, 6400874 - 6400963
Alignment:
258 accccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggactcttaaca 347  Q
    |||||| ||||||||||| |||| ||||||||||| ||||||||||||| ||||||||| |||||| | |||||||||||||||||||||    
6400874 accccacaaaaccggcttgtgaggtgaggattgcctccacttataaacatattgtcaggccatgtcatgtccgatgtgggactcttaaca 6400963  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #38
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 231 - 347
Target Start/End: Original strand, 2736403 - 2736519
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccg 330  Q
    |||||||| |||||| ||| |||||||| || | ||||||| ||| |||  |||| |||||||||||||||||||||||| ||||||||| || ||||||    
2736403 ttagaaatcgtggttaggcttaacacaatccaacaaaaccgacttgtgatgtgagaattgcccccacttataaacacattatcaggtcatctcatatccg 2736502  T
331 atgtgggactcttaaca 347  Q
    |||||| ||||||||||    
2736503 atgtggaactcttaaca 2736519  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #39
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 229 - 361
Target Start/End: Original strand, 5648671 - 5648803
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    ||||||||||  ||||||| |||||||||||| || ||||||||||| |||| ||| ||||| ||  | |||||||||||||| || ||||| ||||||     
5648671 tcttagaaattatggttggacctaacacaacctcacaaaaccggcttgtgaggtgatgattgtccttaattataaacacattggcaagtcatctcctatt 5648770  T
329 cgatgtgggactcttaacacccccctcacaacc 361  Q
    |||||| ||| ||||||||| ||||||||||||    
5648771 cgatgtaggaatcttaacacacccctcacaacc 5648803  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #40
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 229 - 306
Target Start/End: Complemental strand, 19712801 - 19712722
Alignment:
229 tcttagaaatggtggttgggcctaacaca--accccataaaaccggcttctgagatgaggattgcccccacttataaaca 306  Q
    |||||||||||||||||||||||||||||  |||||| ||||||||||| |||| |||||||||||||||||||||||||    
19712801 tcttagaaatggtggttgggcctaacacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaaca 19712722  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #41
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 234 - 341
Target Start/End: Original strand, 16722811 - 16722918
Alignment:
234 gaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatg 333  Q
    ||||| |||||||||||||||||||||||| |||| |||||| |||| |||| ||||| |||||||||||||| ||| ||||| |||  | |||||||||    
16722811 gaaatagtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagaattgctcccacttataaacagattatcaggccatcacatatccgatg 16722910  T
334 tgggactc 341  Q
    ||||||||    
16722911 tgggactc 16722918  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #42
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 229 - 347
Target Start/End: Complemental strand, 11085666 - 11085548
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| ||| |||| |||||||||||| || ||||||||||| |||  |||| |||||||||||||||||||| |||||| || ||| ||||| |    
11085666 tcttagaaatcgtgattggacctaacacaaccgcacaaaaccggcttgtgaagtgagaattgcccccacttataaacatattgtcgggccatctcctacc 11085567  T
329 cgatgtgggactcttaaca 347  Q
    ||||||| |||| ||||||    
11085566 cgatgtgagactattaaca 11085548  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #43
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 250 - 347
Target Start/End: Complemental strand, 4906870 - 4906773
Alignment:
250 ctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggactcttaaca 347  Q
    ||||||||| |||||||||| ||||| ||||||||||||||||| ||||||||||||||||||| |   || || |||||||||||| ||||||||||    
4906870 ctaacacaatcccataaaactggcttgtgagatgaggattgccctcacttataaacacattgtccgacaatctcttatccgatgtggaactcttaaca 4906773  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #44
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 277 - 357
Target Start/End: Complemental strand, 3680283 - 3680203
Alignment:
277 tgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggactcttaacacccccctcac 357  Q
    |||| ||| ||||||||||||||||||||||||||||||  |||  | |||||||||||||||||||||||||||||||||    
3680283 tgaggtgatgattgcccccacttataaacacattgtcagaccatcacatatccgatgtgggactcttaacacccccctcac 3680203  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #45
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 229 - 347
Target Start/End: Complemental strand, 7915934 - 7915817
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgccccc-acttataaacacattgtcaggtcatgtcctat 327  Q
    |||||||||| ||||||||| ||||||  |||||| |||| |||||| |||| |||||||||||||| ||||||||||||||||||||| ||  | ||||    
7915934 tcttagaaatcgtggttgggtctaaca--accccacaaaatcggcttgtgaggtgaggattgccccccacttataaacacattgtcaggccaacttctat 7915837  T
328 ccgatgtgggactcttaaca 347  Q
    || |||| ||||||||||||    
7915836 ccaatgttggactcttaaca 7915817  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #46
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 229 - 344
Target Start/End: Original strand, 12199803 - 12199919
Alignment:
229 tcttagaaatggtggtt-gggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctat 327  Q
    |||||||||| |||||| ||||||||||||||  || ||||| | ||| |||| ||| ||||||||||||||||||||| ||||||||  ||| || |||    
12199803 tcttagaaatcgtggtttgggcctaacacaacatcacaaaacggacttgtgaggtgatgattgcccccacttataaacatattgtcagaccatatcttat 12199902  T
328 ccgatgtgggactctta 344  Q
    |||||||||||||||||    
12199903 ccgatgtgggactctta 12199919  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #47
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 240 - 347
Target Start/End: Original strand, 2737180 - 2737287
Alignment:
240 gtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggac 339  Q
    |||||| ||| |||||||| || | ||||||| ||| |||  |||| |||||||||||||||||||||||| ||||||||| || |||||||||||| ||    
2737180 gtggttaggcttaacacaatccaacaaaaccgacttgtgatgtgagaattgcccccacttataaacacattatcaggtcatctcatatccgatgtggaac 2737279  T
340 tcttaaca 347  Q
    ||||||||    
2737280 tcttaaca 2737287  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #48
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 229 - 348
Target Start/End: Original strand, 6542708 - 6542826
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| |||||||| | ||||||||||| | |||||||| || |||| ||| ||||||||| | ||||||||| ||||||||  ||| |||||||    
6542708 tcttagaaatcgtggttggacttaacacaaccctacaaaaccggtttgtgaggtgatgattgcccc-atttataaacagattgtcagaccatctcctatc 6542806  T
329 cgatgtgggactcttaacac 348  Q
    ||||||| ||||||||||||    
6542807 cgatgtgagactcttaacac 6542826  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #49
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 229 - 343
Target Start/End: Complemental strand, 16570244 - 16570130
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    ||||||||||  ||||||||||||||||||||||| ||||||| ||| | |  |||||||| ||||| |||||||||||||||||||| ||| || ||||    
16570244 tcttagaaatcatggttgggcctaacacaaccccacaaaaccgacttgttacgtgaggattacccccgcttataaacacattgtcaggacatctcttatc 16570145  T
329 cgatgtgggactctt 343  Q
      |||||| ||||||    
16570144 ttatgtggtactctt 16570130  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #50
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 251 - 348
Target Start/End: Complemental strand, 33494838 - 33494740
Alignment:
251 taacacaaccccataaaaccggcttctgagatgaggattgc-ccccacttataaacacattgtcaggtcatgtcctatccgatgtgggactcttaacac 348  Q
    ||||||||||||||||||||||||| |||| |||||| |   ||||||||||||| | ||||||||  ||| |||||||||||||||||||||||||||    
33494838 taacacaaccccataaaaccggcttgtgaggtgaggaataatccccacttataaatatattgtcagaccatctcctatccgatgtgggactcttaacac 33494740  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #51
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 229 - 334
Target Start/End: Complemental strand, 3713427 - 3713322
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| ||||||| |||||||||||||  | |||| |||||| |||  ||||||||||| | |||||||||||||||||||||||||  ||||||    
3713427 tcttagaaattgtggttgtgcctaacacaaccttacaaaatcggcttttgatgtgaggattgcctcaacttataaacacattgtcaggtcatcacctatc 3713328  T
329 cgatgt 334  Q
     |||||    
3713327 tgatgt 3713322  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #52
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 231 - 348
Target Start/End: Original strand, 5572617 - 5572733
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccg 330  Q
    |||||||| ||||||||||| |||| ||||||| ||| ||||||| |||| ||||||| ||||||||||||||||| ||||||| | ||  |||||  ||    
5572617 ttagaaatcgtggttgggccgaacaaaaccccacaaa-ccggcttgtgaggtgaggatggcccccacttataaacaaattgtcatgccaactcctaaacg 5572715  T
331 atgtgggactcttaacac 348  Q
    |||||||| |||||||||    
5572716 atgtgggattcttaacac 5572733  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #53
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 231 - 296
Target Start/End: Complemental strand, 8026687 - 8026622
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgccccca 296  Q
    |||||||| |||||||||||||||||||||||| ||||||||||| |||| |||||||||||||||    
8026687 ttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgccccca 8026622  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #54
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 241 - 333
Target Start/End: Original strand, 33631816 - 33631907
Alignment:
241 tggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatg 333  Q
    ||||||| |||||| |||||||| |||||||| || |||| |||||||||  ||||||||||||||||||||||||||||  |||||||||||    
33631816 tggttggacctaactcaaccccacaaaaccgg-ttatgaggtgaggattgttcccacttataaacacattgtcaggtcatcacctatccgatg 33631907  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #55
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 229 - 299
Target Start/End: Original strand, 6623409 - 6623479
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccactt 299  Q
    |||||||||| |||||||| ||||||||||||||| ||||||||||| | || ||||||||||||||||||    
6623409 tcttagaaatcgtggttggacctaacacaaccccacaaaaccggcttgtaaggtgaggattgcccccactt 6623479  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #56
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 282 - 348
Target Start/End: Original strand, 7638642 - 7638708
Alignment:
282 tgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggactcttaacac 348  Q
    ||||||||||||||||||||||||||||| ||||||||| ||||||| || ||| ||||||||||||    
7638642 tgaggattgcccccacttataaacacattatcaggtcatctcctatctgacgtgagactcttaacac 7638708  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #57
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 229 - 306
Target Start/End: Original strand, 8001549 - 8001626
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaaca 306  Q
    |||||||||| |||||||||||||||||||||| | |||| || ||| |||| ||| |||||||||||||||||||||    
8001549 tcttagaaattgtggttgggcctaacacaacccaacaaaatcgacttatgaggtgaagattgcccccacttataaaca 8001626  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #58
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 297 - 357
Target Start/End: Complemental strand, 13353453 - 13353392
Alignment:
297 cttataaacacattgtcaggtcatgtcctatccgatgtgggactcttaacac-ccccctcac 357  Q
    |||||||||||||||||||| |||||||| |||||||||||||||||||||| |||||||||    
13353453 cttataaacacattgtcaggccatgtcctgtccgatgtgggactcttaacacaccccctcac 13353392  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #59
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 297 - 357
Target Start/End: Complemental strand, 33796578 - 33796517
Alignment:
297 cttataaacacattgtcaggtcatgtcctatccgatgtgggactcttaacac-ccccctcac 357  Q
    |||||||||||||||||||| |||||||| |||||||||||||||||||||| |||||||||    
33796578 cttataaacacattgtcaggccatgtcctgtccgatgtgggactcttaacacaccccctcac 33796517  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #60
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 231 - 315
Target Start/End: Complemental strand, 13740764 - 13740680
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcag 315  Q
    |||||||| ||||||| ||||||||||||| || ||||||| ||| ||||  |||||||| | ||||||||||||||||||||||    
13740764 ttagaaatcgtggttgagcctaacacaacctcacaaaaccgacttatgaggcgaggattgtctccacttataaacacattgtcag 13740680  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #61
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 231 - 315
Target Start/End: Complemental strand, 13746264 - 13746180
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcag 315  Q
    |||||||| ||||||| ||||||||||||| || ||||||| ||| ||||  |||||||| | ||||||||||||||||||||||    
13746264 ttagaaatcgtggttgagcctaacacaacctcacaaaaccgacttatgaggcgaggattgtctccacttataaacacattgtcag 13746180  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #62
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 284 - 348
Target Start/End: Complemental strand, 31961208 - 31961144
Alignment:
284 aggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggactcttaacac 348  Q
    ||||||||||||||||||||||||||||||||| |||  | |||| |||||||||||||||||||    
31961208 aggattgcccccacttataaacacattgtcaggccatcacatatctgatgtgggactcttaacac 31961144  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #63
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 229 - 348
Target Start/End: Original strand, 10145749 - 10145868
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| ||||||| |||||||||||||| | ||||| | ||| |||| |||  |||| ||| | ||||||||||||| ||||||||| ||| |||    
10145749 tcttagaaattgtggttgagcctaacacaaccctacaaaactgacttgtgaggtgaaaattgtccctatttataaacacattatcaggtcatctcccatc 10145848  T
329 cgatgtgggactcttaacac 348  Q
    | ||||| || |||||||||    
10145849 caatgtgagattcttaacac 10145868  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #64
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 233 - 348
Target Start/End: Complemental strand, 32291043 - 32290929
Alignment:
233 agaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgat 332  Q
    |||||| |||||||||||||||| || |||| ||||||| | |  ||||||||||||| ||||| |||||||||||||| ||| | || | ||||| |||    
32291043 agaaatcgtggttgggcctaacataagcccacaaaaccgacctgcgagatgaggattg-ccccatttataaacacattgccagataatcttctatctgat 32290945  T
333 gtgggactcttaacac 348  Q
    |||||||| |||||||    
32290944 gtgggacttttaacac 32290929  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #65
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 249 - 343
Target Start/End: Complemental strand, 3823369 - 3823275
Alignment:
249 cctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggactctt 343  Q
    |||||||||||||||||||| | | || |||  ||| ||||| ||||||||||||||| ||| ||||||||| || ||||||||||| |||||||    
3823369 cctaacacaaccccataaaatcagtttgtgatgtgatgattgtccccacttataaacaaattatcaggtcatctcttatccgatgtgagactctt 3823275  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #66
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 277 - 347
Target Start/End: Original strand, 12199732 - 12199802
Alignment:
277 tgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggactcttaaca 347  Q
    |||| |||||||| |||||||||||||| ||||||||||||||||| ||||| ||| |||||| |||||||    
12199732 tgaggtgaggattacccccacttataaatacattgtcaggtcatgttctatctgatatgggacgcttaaca 12199802  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #67
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 253 - 347
Target Start/End: Complemental strand, 15600997 - 15600903
Alignment:
253 acacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggactcttaaca 347  Q
    ||||||||||| ||||| | ||| |||  ||||||||||||||||||||||||| ||| ||||  ||  ||||| ||||||||||||||||||||    
15600997 acacaaccccacaaaactgacttgtgaagtgaggattgcccccacttataaacaaattatcagaccaactcctaaccgatgtgggactcttaaca 15600903  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #68
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 282 - 347
Target Start/End: Complemental strand, 6369496 - 6369431
Alignment:
282 tgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggactcttaaca 347  Q
    ||||||||||||||||||||||||||||||| || ||||  ||| ||| |||||||||||||||||    
6369496 tgaggattgcccccacttataaacacattgttagatcatcacctgtccaatgtgggactcttaaca 6369431  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #69
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 247 - 352
Target Start/End: Complemental strand, 21215052 - 21214947
Alignment:
247 ggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggactcttaac 346  Q
    ||||||||||||||||| ||||||| ||| |||| ||| ||||||||  ||||||||||||||||| ||  |||  ||||| ||| ||| ||||||||||    
21215052 ggcctaacacaaccccacaaaaccgacttttgaggtgatgattgcccaaacttataaacacattgtgagaccatcacctattcgacgtgtgactcttaac 21214953  T
347 accccc 352  Q
    | ||||    
21214952 aacccc 21214947  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #70
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 265 - 353
Target Start/End: Complemental strand, 30505787 - 30505698
Alignment:
265 aaaaccggcttctgagatgaggattgcccccactt-ataaacacattgtcaggtcatgtcctatccgatgtgggactcttaacacccccc 353  Q
    |||| |||||| |||| ||||||||| |||||||| | ||||||||||||||  ||| |  |||||||||||||||||||||||||||||    
30505787 aaaatcggcttatgaggtgaggattgtccccactttacaaacacattgtcagaccatcttatatccgatgtgggactcttaacacccccc 30505698  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #71
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 240 - 315
Target Start/End: Complemental strand, 6066049 - 6065976
Alignment:
240 gtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcag 315  Q
    |||||||||||||||||||||||| ||||||  ||| | || |||||||||||||  |||||||||||||||||||    
6066049 gtggttgggcctaacacaaccccacaaaaccaacttgtcaggtgaggattgcccc--cttataaacacattgtcag 6065976  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #72
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 268 - 347
Target Start/End: Original strand, 6237740 - 6237819
Alignment:
268 accggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggactcttaaca 347  Q
    |||||||| |||| |||||||||||| |||||||||| ||||||||||| | |  | ||||| |||||||||||||||||    
6237740 accggcttgtgaggtgaggattgccctcacttataaatacattgtcaggccttcacttatccaatgtgggactcttaaca 6237819  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #73
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 265 - 340
Target Start/End: Original strand, 15102966 - 15103041
Alignment:
265 aaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggact 340  Q
    ||||||||| | |||  |||| ||||||||| ||||||||||||||||||||||||  ||||||||||||| ||||    
15102966 aaaaccggcctgtgaagtgagaattgcccccgcttataaacacattgtcaggtcatcacctatccgatgtgagact 15103041  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #74
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 229 - 344
Target Start/End: Original strand, 30849401 - 30849516
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| ||  || || ||| |||||||||| |||||||||||  ||  |||||||||| ||||||||||| ||||||| ||  |||| || ||||    
30849401 tcttagaaatcgtaattaggtctagcacaaccccacaaaaccggcttgcgatgtgaggattgctcccacttataagcacattgccatatcatctcatatc 30849500  T
329 cgatgtgggactctta 344  Q
    ||||||| ||||||||    
30849501 cgatgtgagactctta 30849516  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #75
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 231 - 313
Target Start/End: Original strand, 15082145 - 15082226
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtc 313  Q
    |||||||| ||| ||||||||||||||| |||| ||||||||||| |||| |||||| ||   ||||||||||||||||||||    
15082145 ttagaaatcgtgtttgggcctaacacaatcccacaaaaccggcttgtgaggtgaggactg-ttccacttataaacacattgtc 15082226  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #76
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 228 - 320
Target Start/End: Original strand, 4161844 - 4161937
Alignment:
228 ctcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgccccc-acttataaacacattgtcaggtcat 320  Q
    ||||||||||| |||||||||||||||||||||||| ||||| || || || | ||| |||| ||||| ||||| ||||||||  |||||||||    
4161844 ctcttagaaatcgtggttgggcctaacacaaccccacaaaactggattgtgtggtgaagattccccccgacttagaaacacatgttcaggtcat 4161937  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #77
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 228 - 320
Target Start/End: Original strand, 4223464 - 4223557
Alignment:
228 ctcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgccccc-acttataaacacattgtcaggtcat 320  Q
    ||||||||||| |||||||||||||||||||||||| ||||| || || || | ||| |||| ||||| ||||| ||||||||  |||||||||    
4223464 ctcttagaaatcgtggttgggcctaacacaaccccacaaaactggattgtgtggtgaagattccccccgacttagaaacacatgttcaggtcat 4223557  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #78
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 229 - 347
Target Start/End: Complemental strand, 6054254 - 6054136
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| ||||||| | ||||||| | |||| ||||| | ||| |||| ||| ||||| || |||||||||||| ||||||||  ||| || ||      
6054254 tcttagaaatcgtggttgagtctaacacgatcccacaaaactgacttatgaggtgatgattgtcctcacttataaacagattgtcagaccatatcttaaa 6054155  T
329 cgatgtgggactcttaaca 347  Q
    |||||| ||||||||||||    
6054154 cgatgtaggactcttaaca 6054136  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #79
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 241 - 307
Target Start/End: Original strand, 7333093 - 7333159
Alignment:
241 tggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacac 307  Q
    ||||||||||||||||||||| | ||||| ||||| |||| ||||||  ||| ||||||||||||||    
7333093 tggttgggcctaacacaaccctacaaaactggcttgtgaggtgaggaccgcctccacttataaacac 7333159  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #80
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 277 - 347
Target Start/End: Complemental strand, 11085850 - 11085780
Alignment:
277 tgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggactcttaaca 347  Q
    |||| |||| ||||| |||||||||||| | |||| |||||||| |||||||||||||| |||| ||||||    
11085850 tgaggtgagcattgctcccacttataaatatattggcaggtcatctcctatccgatgtgagacttttaaca 11085780  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #81
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 265 - 346
Target Start/End: Complemental strand, 467660 - 467579
Alignment:
265 aaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggactcttaac 346  Q
    ||||||||||| |||| |||||| | ||||||||| |||||||||||||||| |   ||  |||| ||||||||||||||||    
467660 aaaaccggcttatgaggtgaggacttcccccacttgtaaacacattgtcaggacgcatctcatccaatgtgggactcttaac 467579  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #82
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 263 - 348
Target Start/End: Complemental strand, 3713081 - 3712996
Alignment:
263 ataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggactcttaacac 348  Q
    ||||||||| ||| |||| ||||  |||||| ||||| ||||||||||||||| ||||  || |||||||||| || |||||||||    
3713081 ataaaaccgacttttgaggtgagatttgcccgcacttttaaacacattgtcagatcattaccaatccgatgtgcgattcttaacac 3712996  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #83
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 343
Target Start/End: Original strand, 12319727 - 12319787
Alignment:
283 gaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggactctt 343  Q
    |||| ||||||||||||||||||||||||||| ||||| || ||||  ||||| |||||||    
12319727 gagggttgcccccacttataaacacattgtcatgtcatctcttatctaatgtgagactctt 12319787  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #84
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 231 - 347
Target Start/End: Complemental strand, 12885140 - 12885021
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgccccc-acttata--aacacattgtcaggtcatgtcctat 327  Q
    |||||||| |||||| | ||||||||||||||| |||| | |||  | || ||| |||||||||| |||||||  |||||||||||||||||| || ||     
12885140 ttagaaatcgtggttagacctaacacaaccccacaaaatcagctcgtaaggtgatgattgccccctacttatataaacacattgtcaggtcatctcttaa 12885041  T
328 ccgatgtgggactcttaaca 347  Q
    | |||||| |||| ||||||    
12885040 ctgatgtgagacttttaaca 12885021  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #85
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 229 - 301
Target Start/End: Complemental strand, 20373655 - 20373584
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttat 301  Q
    ||||| |||| |||||||||||||||||||||||| ||||  ||||| |||| |||||||||||  |||||||    
20373655 tcttataaatcgtggttgggcctaacacaaccccacaaaa-tggcttgtgaggtgaggattgccatcacttat 20373584  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #86
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 229 - 306
Target Start/End: Complemental strand, 4148861 - 4148784
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaaca 306  Q
    |||||||| | |||||||  | |||||||||| || ||||| ||||| |||||||| |||||||  ||||||||||||    
4148861 tcttagaagttgtggttgcacataacacaacctcaaaaaacaggcttatgagatgatgattgccgtcacttataaaca 4148784  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #87
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 306 - 347
Target Start/End: Complemental strand, 30505511 - 30505470
Alignment:
306 acattgtcaggtcatgtcctatccgatgtgggactcttaaca 347  Q
    ||||||||||| ||| |||||||||||||| |||||||||||    
30505511 acattgtcaggccatctcctatccgatgtgagactcttaaca 30505470  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #88
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 242 - 306
Target Start/End: Complemental strand, 5609197 - 5609133
Alignment:
242 ggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaaca 306  Q
    |||||| || |||||||||||| ||||| ||||| | | || |||||||| ||||||||||||||    
5609197 ggttggaccaaacacaaccccacaaaactggcttgtaatataaggattgctcccacttataaaca 5609133  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #89
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 257 - 309
Target Start/End: Original strand, 33631638 - 33631690
Alignment:
257 aaccccataaaaccggcttctgagatgaggattgcccccacttataaacacat 309  Q
    ||||||| |||||||| || |  | ||||||||||||||||||||||||||||    
33631638 aaccccacaaaaccggtttatatggtgaggattgcccccacttataaacacat 33631690  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 99; Significance: 9e-49; HSPs: 108)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 99; E-Value: 9e-49
Query Start/End: Original strand, 228 - 357
Target Start/End: Original strand, 41666755 - 41666885
Alignment:
228 ctcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctat 327  Q
    ||||||||||| |||||||||||||||||||||||| ||||||||||| |||| ||||||||||||||||||||||||||||||||||| |||||||| |    
41666755 ctcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacacattgtcaggccatgtcctgt 41666854  T
328 ccgatgtgggactcttaacac-ccccctcac 357  Q
    ||||||||||||||||||||| |||||||||    
41666855 ccgatgtgggactcttaacacaccccctcac 41666885  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 229 - 357
Target Start/End: Original strand, 24346500 - 24346629
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| ||||||| |||||||||||||||||||||||||||| |||| |||||||| |||||||||||||||||||||||||| |||||||||||    
24346500 tcttagaaattgtggttgagcctaacacaaccccataaaaccggcttgtgaggtgaggattacccccacttataaacacattgtcaggccatgtcctatc 24346599  T
329 cgatgtgggactcttaacac-ccccctcac 357  Q
    |||||||||||||||||||| |||||||||    
24346600 cgatgtgggactcttaacacaccccctcac 24346629  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 229 - 357
Target Start/End: Original strand, 8081112 - 8081242
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccc-cacttataaacacattgtcaggtcatgtcctat 327  Q
    ||||||||||  ||||||||||||||||||||||| ||||||||||| |||||||||||||||||| |||||||||||||||||||||| ||||||||||    
8081112 tcttagaaatcatggttgggcctaacacaaccccacaaaaccggcttgtgagatgaggattgccccccacttataaacacattgtcaggccatgtcctat 8081211  T
328 ccgatgtgggactcttaacac-ccccctcac 357  Q
    ||||||||||||||||||||| |||||||||    
8081212 ccgatgtgggactcttaacacaccccctcac 8081242  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 229 - 347
Target Start/End: Original strand, 41666992 - 41667110
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| |||||||||||||||||||||||| ||||||||||| |||| ||||||||||||||||||||||||||||||||||| |||||||| ||    
41666992 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacacattgtcaggccatgtcctgtc 41667091  T
329 cgatgtgggactcttaaca 347  Q
    |||||||||||||||||||    
41667092 cgatgtgggactcttaaca 41667110  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 229 - 357
Target Start/End: Original strand, 24269870 - 24269998
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| ||||||| |||||||||||||||||||||||||||| |||| |||||||| |||| ||||||||||||||||||||| |||||||||||    
24269870 tcttagaaattgtggttgagcctaacacaaccccataaaaccggcttgtgaggtgaggattacccc-acttataaacacattgtcaggccatgtcctatc 24269968  T
329 cgatgtgggactcttaacac-ccccctcac 357  Q
    |||||||||||||||||||| |||||||||    
24269969 cgatgtgggactcttaacacaccccctcac 24269998  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 228 - 357
Target Start/End: Original strand, 95264 - 95394
Alignment:
228 ctcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctat 327  Q
    ||||||||| |  ||||||||||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||||||||||||||||||  |||||    
95264 ctcttagaattcttggttgggcctaacacaaccccacaaaaccggcttgtgagatgaggattgtccccacttataaacacattgtcaggtcatcacctat 95363  T
328 ccgatgtgggactcttaacac-ccccctcac 357  Q
    |||||||| |||||||||||| |||||||||    
95364 ccgatgtgtgactcttaacacaccccctcac 95394  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 86; E-Value: 5e-41
Query Start/End: Original strand, 227 - 348
Target Start/End: Complemental strand, 19705990 - 19705869
Alignment:
227 tctcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtccta 326  Q
    |||||||||||| |||||||||||||||||||| ||| ||||||||||| | || |||||||||||||||||||||||||||||||||||  ||||||||    
19705990 tctcttagaaatcgtggttgggcctaacacaactccacaaaaccggcttataaggtgaggattgcccccacttataaacacattgtcaggctatgtccta 19705891  T
327 tccgatgtgggactcttaacac 348  Q
     |||||||||||||||||||||    
19705890 cccgatgtgggactcttaacac 19705869  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 229 - 357
Target Start/End: Original strand, 18333464 - 18333592
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||| | |||||||||||||||||||||||| ||||||||||| |||| |||||||| |||||||||||||||||||||||||  ||| |||||||    
18333464 tcttagaatttgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattacccccacttataaacacattgtcagaccatctcctatc 18333563  T
329 cgatgtgggactcttaacacccccctcac 357  Q
    |||||||||| ||||||||| ||||||||    
18333564 cgatgtgggattcttaacacacccctcac 18333592  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 229 - 347
Target Start/End: Original strand, 2063733 - 2063850
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| |||||||||||||||||||||||| ||||||| ||| |||| ||||||||||||||||||||||||||||||||||  ||||| |||||    
2063733 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccgacttgtgag-tgaggattgcccccacttataaacacattgtcagaccatgttctatc 2063831  T
329 cgatgtgggactcttaaca 347  Q
    |||||||||||||||||||    
2063832 cgatgtgggactcttaaca 2063850  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 229 - 357
Target Start/End: Complemental strand, 43117967 - 43117838
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    ||||| |||| || ||||||||||||||||||| ||||||||||||| ||||||||||||||||| || ||||||||||||||||||| |||||||| ||    
43117967 tcttaaaaatcgttgttgggcctaacacaaccctataaaaccggcttgtgagatgaggattgccctcatttataaacacattgtcaggccatgtcctgtc 43117868  T
329 cgatg-tgggactcttaacacccccctcac 357  Q
    ||| | ||||||||||||||||||||||||    
43117867 cgaagttgggactcttaacacccccctcac 43117838  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 79; E-Value: 8e-37
Query Start/End: Original strand, 229 - 348
Target Start/End: Complemental strand, 15480644 - 15480523
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattg--cccccacttataaacacattgtcaggtcatgtccta 326  Q
    |||||||||| |||||||||||||||||||||||| ||||||||||| |||| |||||||||  ||||||||||||||||| |||||||| |||||| ||    
15480644 tcttagaaattgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgatcccccacttataaacacgttgtcaggccatgtcata 15480545  T
327 tccgatgtgggactcttaacac 348  Q
    || |||||||||||||||||||    
15480544 tctgatgtgggactcttaacac 15480523  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 79; E-Value: 8e-37
Query Start/End: Original strand, 229 - 347
Target Start/End: Complemental strand, 24531684 - 24531567
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| |||||||||| ||||||||||||| |||| |||||| |||| |||||||||||||||||||||||||||||||||||||||||||| ||    
24531684 tcttagaaatcgtggttgggcataacacaaccccacaaaatcggcttgtgaggtgaggattgcccccacttataaacacattgtcaggtcatgtcctctc 24531585  T
329 cgatgtgggactcttaaca 347  Q
    ||||  |||||||||||||    
24531584 cgat-cgggactcttaaca 24531567  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 79; E-Value: 8e-37
Query Start/End: Original strand, 229 - 343
Target Start/End: Complemental strand, 28510176 - 28510062
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| |||||||||||||||||||||||| ||||||||||| ||||||||||||||||  |||||||||||||||||||||||||| || ||||    
28510176 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttatgagatgaggattgccttcacttataaacacattgtcaggtcatctcttatc 28510077  T
329 cgatgtgggactctt 343  Q
     ||||| ||||||||    
28510076 tgatgttggactctt 28510062  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 76; E-Value: 5e-35
Query Start/End: Original strand, 231 - 357
Target Start/End: Original strand, 27132994 - 27133121
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccg 330  Q
    |||||||| |||||||||||||||||||||||| ||||||||||| |||| |||||||||||| |||||||||||| ||||||||| ||  ||||| |||    
27132994 ttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgccctcacttataaacaaattgtcaggccaactcctaaccg 27133093  T
331 atgtgggactcttaacac-ccccctcac 357  Q
    ||||| |||||||||||| |||||||||    
27133094 atgtgagactcttaacacaccccctcac 27133121  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #15
Raw Score: 74; E-Value: 7e-34
Query Start/End: Original strand, 230 - 347
Target Start/End: Complemental strand, 9368679 - 9368562
Alignment:
230 cttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatcc 329  Q
    |||||||||  ||||||||||||||||||||||| ||||||||||| |||| ||||||||||| ||||||||||||||||||||| | ||| ||||||||    
9368679 cttagaaattatggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcacgccatctcctatcc 9368580  T
330 gatgtgggactcttaaca 347  Q
    |||||  |||||||||||    
9368579 gatgtatgactcttaaca 9368562  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #16
Raw Score: 74; E-Value: 7e-34
Query Start/End: Original strand, 229 - 357
Target Start/End: Complemental strand, 9368915 - 9368786
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| |||||||||||||||||||||||| | || |||||| |||  |||| |||||||||||||||||||||||||||| | ||| |||||||    
9368915 tcttagaaattgtggttgggcctaacacaaccccacataatcggcttgtgaagtgagaattgcccccacttataaacacattgtcatgccatctcctatc 9368816  T
329 cgatgtgggactcttaacac-ccccctcac 357  Q
    ||||||||||||||||| || |||||||||    
9368815 cgatgtgggactcttaagacaccccctcac 9368786  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #17
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 229 - 341
Target Start/End: Complemental strand, 15480407 - 15480295
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| |||||||||||||||| ||||||| |||||| |||| |||| ||||||||||||||||||||||||||||||||||  |||  ||||||    
15480407 tcttagaaatcgtggttgggcctaacagaaccccacaaaaccagcttgtgaggtgaggattgcccccacttataaacacattgtcagaccatcacctatc 15480308  T
329 cgatgtgggactc 341  Q
    |||||||||||||    
15480307 cgatgtgggactc 15480295  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #18
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 228 - 348
Target Start/End: Original strand, 17352433 - 17352552
Alignment:
228 ctcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctat 327  Q
    ||||||||| ||||||||| ||||||| ||||| || ||||||||||| |||| ||| ||||||||||||||||||||||||||||||||||| || |||    
17352433 ctcttagaagtggtggttgagcctaacgcaacctcacaaaaccggcttgtgaggtgatgattgcccccacttataaacacattgtcaggtcatctcttat 17352532  T
328 ccgatgtgggactcttaacac 348  Q
     ||||||||||||||||||||    
17352533 -cgatgtgggactcttaacac 17352552  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #19
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 229 - 347
Target Start/End: Original strand, 24346736 - 24346854
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    ||||| |||| ||||||||| |||||||||||||| ||||||||||| |||| |||| ||| |||||||||||||| ||||||||||| |||||| |||     
24346736 tcttaaaaatcgtggttgggtctaacacaaccccacaaaaccggcttgtgaggtgagtattacccccacttataaatacattgtcaggccatgtcttatt 24346835  T
329 cgatgtgggactcttaaca 347  Q
    |||||||||||||||||||    
24346836 cgatgtgggactcttaaca 24346854  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #20
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 229 - 347
Target Start/End: Complemental strand, 24528625 - 24528508
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    ||||||||||  ||||||||||||||||||||||| ||||||||||| |||| ||||||||||||||||||||||||||||||||||  |||||||| ||    
24528625 tcttagaaatcatggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacacattgtcagaccatgtcctctc 24528526  T
329 cgatgtgggactcttaaca 347  Q
     |||  |||||||||||||    
24528525 tgat-cgggactcttaaca 24528508  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #21
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 229 - 357
Target Start/End: Original strand, 20510641 - 20510770
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| ||| |||||||||||||||| ||| ||||| || || |||| ||||||||||||||||||||||||| ||||||||| |||  ||||||    
20510641 tcttagaaatcgtgtttgggcctaacacaactccacaaaactggtttttgaggtgaggattgcccccacttataaacatattgtcaggccatcacctatc 20510740  T
329 cgatgtgggactcttaacac-ccccctcac 357  Q
    ||||||||| |||||||||| |||||||||    
20510741 cgatgtggggctcttaacacaccccctcac 20510770  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #22
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 232 - 349
Target Start/End: Complemental strand, 24647778 - 24647661
Alignment:
232 tagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccga 331  Q
    ||||||| |||||||| ||||||||||| ||| ||||||||||| |||| ||||||||||| ||| |||||||||||||||| || |||  |||||||||    
24647778 tagaaatcgtggttggacctaacacaactccacaaaaccggcttgtgaggtgaggattgccaccagttataaacacattgtccggccatcacctatccga 24647679  T
332 tgtgggactcttaacacc 349  Q
    ||||||||||||||||||    
24647678 tgtgggactcttaacacc 24647661  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #23
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 265 - 361
Target Start/End: Original strand, 30770084 - 30770181
Alignment:
265 aaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggactcttaacac-ccccctcacaacc 361  Q
    |||||||| || |||| |||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
30770084 aaaaccggtttatgaggtgaggattgcccccacttttaaaaacattgtcaggtcatgtcctatccgatgtgggactcttaacacaccccctcacaacc 30770181  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #24
Raw Score: 69; E-Value: 7e-31
Query Start/End: Original strand, 231 - 347
Target Start/End: Complemental strand, 8098400 - 8098285
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccg 330  Q
    |||||||| |||||||||| ||||||||||||| ||||||||||| |||| ||||||||| ||||||||||||||| ||||||||| ||  ||||| |||    
8098400 ttagaaatcgtggttgggcttaacacaaccccacaaaaccggcttgtgaggtgaggattg-ccccacttataaacaaattgtcaggccaactcctaaccg 8098302  T
331 atgtgggactcttaaca 347  Q
    |||||||||||||||||    
8098301 atgtgggactcttaaca 8098285  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #25
Raw Score: 69; E-Value: 7e-31
Query Start/End: Original strand, 231 - 347
Target Start/End: Original strand, 21209922 - 21210038
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccg 330  Q
    |||||||| |||||||||| ||||||||||||| ||||||||||| |||| |||| |||| ||||||||||||||| ||||||||| ||  ||||| |||    
21209922 ttagaaatcgtggttgggcttaacacaaccccacaaaaccggcttgtgaggtgagaattgtccccacttataaacaaattgtcaggccaactcctaaccg 21210021  T
331 atgtgggactcttaaca 347  Q
    |||||||||||||||||    
21210022 atgtgggactcttaaca 21210038  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #26
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 226 - 357
Target Start/End: Original strand, 38731599 - 38731730
Alignment:
226 gtctcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcct 325  Q
    |||||||||||||| ||||||| |||||||||||| ||||||| |||||| |||| ||  |||||| | |||||||||| | ||||||||||||| ||||    
38731599 gtctcttagaaatgatggttggacctaacacaacctcataaaatcggcttgtgaggtggtgattgctctcacttataaataaattgtcaggtcatctcct 38731698  T
326 atccgatgtgggactcttaacacccccctcac 357  Q
    ||||||||||| || |||||||| ||||||||    
38731699 atccgatgtggaacacttaacacacccctcac 38731730  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #27
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 229 - 345
Target Start/End: Original strand, 13701067 - 13701183
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| |||||| |||||||||| |||||| ||||||| ||  || | |||| ||||||||||||||||||||||||||| | |||| |||||||    
13701067 tcttagaaatcgtggttaggcctaacacgaccccacaaaaccgactcttggggtgagaattgcccccacttataaacacattgtcggatcatttcctatc 13701166  T
329 cgatgtgggactcttaa 345  Q
    |||||||||||||||||    
13701167 cgatgtgggactcttaa 13701183  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #28
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 229 - 340
Target Start/End: Complemental strand, 21306972 - 21306861
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| ||||||||| ||||||||| |||| || |||||||| |||| ||||||||||||||||||||||| |||||| |||  |||||||| ||    
21306972 tcttagaaatcgtggttgggtctaacacaatcccacaataccggcttgtgaggtgaggattgcccccacttataaatacattggcagaccatgtcctgtc 21306873  T
329 cgatgtgggact 340  Q
    ||||||||||||    
21306872 cgatgtgggact 21306861  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #29
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 229 - 340
Target Start/End: Complemental strand, 21314810 - 21314699
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| ||||||||| ||||||||| |||| || |||||||| |||| ||||||||||||||||||||||| |||||| |||  |||||||| ||    
21314810 tcttagaaatcgtggttgggtctaacacaatcccacaataccggcttgtgaggtgaggattgcccccacttataaatacattggcagaccatgtcctgtc 21314711  T
329 cgatgtgggact 340  Q
    ||||||||||||    
21314710 cgatgtgggact 21314699  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #30
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 229 - 343
Target Start/End: Original strand, 1564566 - 1564680
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| ||||||| |||||||||||||||| ||||| | ||| |||  |||||||||||||||||||||| |||||||||||  ||| || ||||    
1564566 tcttagaaatcgtggttgagcctaacacaaccccacaaaactgtcttgtgatgtgaggattgcccccacttataatcacattgtcagaccatctcttatc 1564665  T
329 cgatgtgggactctt 343  Q
    |||||||||||||||    
1564666 cgatgtgggactctt 1564680  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #31
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 235 - 353
Target Start/End: Complemental strand, 6637916 - 6637798
Alignment:
235 aaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgt 334  Q
    |||| ||||||||  |||||||| |||||  ||||||| || |||| |||||||||| |||||||||| ||||||||||||||||| ||||| |||||||    
6637916 aaatcgtggttggatctaacacagccccaataaaccggtttgtgaggtgaggattgcacccacttatagacacattgtcaggtcatctcctaaccgatgt 6637817  T
335 gggactcttaacacccccc 353  Q
    |||||||||||||| ||||    
6637816 gggactcttaacacacccc 6637798  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #32
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 229 - 347
Target Start/End: Original strand, 25258300 - 25258418
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| ||||||| |  ||||||||||||| ||||||| ||| |||| ||||||||||||||||| ||||||| ||||| ||| |||||||| ||    
25258300 tcttagaaatcgtggttgagtttaacacaaccccacaaaaccgacttgtgaggtgaggattgcccccactgataaacatattgttaggccatgtcctgtc 25258399  T
329 cgatgtgggactcttaaca 347  Q
    | |||||||||||||||||    
25258400 caatgtgggactcttaaca 25258418  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #33
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 229 - 347
Target Start/End: Original strand, 25322090 - 25322208
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| ||||||| |  ||||||||||||| ||||||| ||| |||| ||||||||||||||||| ||||||| ||||| ||| |||||||| ||    
25322090 tcttagaaatcgtggttgagtttaacacaaccccacaaaaccgacttgtgaggtgaggattgcccccactgataaacatattgttaggccatgtcctgtc 25322189  T
329 cgatgtgggactcttaaca 347  Q
    | |||||||||||||||||    
25322190 caatgtgggactcttaaca 25322208  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #34
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 229 - 357
Target Start/End: Complemental strand, 13296977 - 13296848
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| ||||||||| ||||||||| |||| |||||||| || |||| ||||| ||||||||||||||||||| ||||||||  ||  ||||| |    
13296977 tcttagaaatcgtggttgggtctaacacaatcccacaaaaccggtttgtgaggtgagggttgcccccacttataaacaaattgtcagaccaactcctaac 13296878  T
329 cgatgtgggactcttaacac-ccccctcac 357  Q
    ||||| |||||||||||||| |||||||||    
13296877 cgatgcgggactcttaacacaccccctcac 13296848  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #35
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 231 - 347
Target Start/End: Original strand, 6413658 - 6413773
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccg 330  Q
    |||||||| || ||||||  ||||||||||||| ||||||||||| |||| ||||||||| ||| |||||||||||||||||||  |||| || ||||||    
6413658 ttagaaatcgttgttgggtttaacacaaccccaaaaaaccggcttatgaggtgaggattgtccctacttataaacacattgtca-atcatctcatatccg 6413756  T
331 atgtgggactcttaaca 347  Q
    |||||||||||||||||    
6413757 atgtgggactcttaaca 6413773  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #36
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 229 - 344
Target Start/End: Original strand, 18333698 - 18333814
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggatt-gcccccacttataaacacattgtcaggtcatgtcctat 327  Q
    |||||||| | |||||||||||||||||||||||| ||||||||||| |||| ||| ||||  |||||||||||||||||||||  ||| ||| ||||||    
18333698 tcttagaattcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgacgattaccccccacttataaacacattgcaaggccatctcctat 18333797  T
328 ccgatgtgggactctta 344  Q
    | |||||||||||||||    
18333798 ctgatgtgggactctta 18333814  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #37
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 229 - 347
Target Start/End: Original strand, 33337454 - 33337568
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| |||||||  ||||||||||||||| |||||||| || |||||||||||||| ||||||||| |   |||||||||||||||  ||||||    
33337454 tcttagaaatcgtggttgaacctaacacaaccccacaaaaccggtttgtgagatgaggattg-ccccacttaca---acattgtcaggtcatcacctatc 33337549  T
329 cgatgtgggactcttaaca 347  Q
    |||||||||||||||||||    
33337550 cgatgtgggactcttaaca 33337568  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #38
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 231 - 347
Target Start/End: Complemental strand, 42295662 - 42295546
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccg 330  Q
    |||||||| || ||||||||||||||||| ||| ||||||||||| |||| |||||||||| |||||||||||||| ||| ||||| ||  ||||| | |    
42295662 ttagaaattgtcgttgggcctaacacaactccacaaaaccggcttgtgaggtgaggattgctcccacttataaacaaattatcaggccaactcctaactg 42295563  T
331 atgtgggactcttaaca 347  Q
    |||||||||||||||||    
42295562 atgtgggactcttaaca 42295546  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #39
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 245 - 340
Target Start/End: Original strand, 6413441 - 6413536
Alignment:
245 tgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggact 340  Q
    |||| |||||||||||||| |||| |||||| |||| ||||||||||||||||||||||||||||||||||||||| || ||||| ||||| ||||    
6413441 tgggtctaacacaaccccacaaaatcggcttatgaggtgaggattgcccccacttataaacacattgtcaggtcatctcatatccaatgtgagact 6413536  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #40
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 229 - 348
Target Start/End: Complemental strand, 12034775 - 12034656
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| ||||||||||||||||||| || | ||||| ||||| |||| |||||||| |||||| |||||||||| ||| |||| ||| || ||||    
12034775 tcttagaaatcgtggttgggcctaacacaatcctacaaaactggcttgtgaggtgaggatttcccccatttataaacacgttggcaggccatctcttatc 12034676  T
329 cgatgtgggactcttaacac 348  Q
    |||| |||||||||||||||    
12034675 cgatatgggactcttaacac 12034656  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #41
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 231 - 357
Target Start/End: Original strand, 26137110 - 26137237
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccg 330  Q
    |||||||| |||||| || |||||| ||||||| |||||||| || |||||||||||||||||||| |||||||||  ||||||  |||| |||||| ||    
26137110 ttagaaatcgtggttaggtctaacataaccccacaaaaccggtttgtgagatgaggattgcccccatttataaacatgttgtcatatcatttcctattcg 26137209  T
331 atgtgggactcttaacac-ccccctcac 357  Q
    ||||||||||||||| || |||||||||    
26137210 atgtgggactcttaatacaccccctcac 26137237  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #42
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 265 - 340
Target Start/End: Original strand, 30758334 - 30758409
Alignment:
265 aaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggact 340  Q
    ||||||||||| |||| |||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||    
30758334 aaaaccggcttatgaggtgaggattgcccccccttataaacacattgtcaggccatgtcctatccgatgtgggact 30758409  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #43
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 229 - 347
Target Start/End: Original strand, 17352667 - 17352785
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    ||||||||||||||||||| ||||||| ||||||  ||||  ||||| |||| ||| |||| |||||||||||||||||||||| ||||||| ||  ||     
17352667 tcttagaaatggtggttggacctaacataaccccgcaaaattggcttgtgaggtgaagattacccccacttataaacacattgttaggtcatctctcatt 17352766  T
329 cgatgtgggactcttaaca 347  Q
    |||||||||||||||||||    
17352767 cgatgtgggactcttaaca 17352785  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #44
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 231 - 348
Target Start/End: Original strand, 24487646 - 24487763
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccg 330  Q
    |||||||| |||||||||| |||||||||| || ||||||||||| |||| |||||||| |||||||||||||||| ||| ||||  ||  ||||| |||    
24487646 ttagaaatcgtggttgggcttaacacaacctcacaaaaccggcttgtgaggtgaggattacccccacttataaacatattttcagaccaactcctaaccg 24487745  T
331 atgtgggactcttaacac 348  Q
    ||||| ||||||||||||    
24487746 atgtgagactcttaacac 24487763  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #45
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 228 - 329
Target Start/End: Original strand, 35167393 - 35167494
Alignment:
228 ctcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctat 327  Q
    ||||||||| | |||||||||||||||||||||||| |||  ||| || ||||||| |||||||||| ||||||||||||||||||||||||| || |||    
35167393 ctcttagaagtcgtggttgggcctaacacaaccccacaaattcggtttgtgagatggggattgccccaacttataaacacattgtcaggtcatctcttat 35167492  T
328 cc 329  Q
    ||    
35167493 cc 35167494  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #46
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 229 - 357
Target Start/End: Original strand, 32908717 - 32908845
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| ||||||||| |||||| ||||||  |||||||| || |||| ||| ||||||| |||||||||||||||||||||| ||||   ||||     
32908717 tcttagaaatcgtggttgggtctaacataacccctcaaaaccggtttgtgaggtgatgattgcctccacttataaacacattgtcagatcatcctctatt 32908816  T
329 cgatgtgggactcttaacacccccctcac 357  Q
    | |||| ||||||||||||| ||||||||    
32908817 caatgtaggactcttaacacacccctcac 32908845  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #47
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 231 - 347
Target Start/End: Original strand, 37782051 - 37782167
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccg 330  Q
    ||||| |||||||||||||||||| |||| ||| |||||| |||| |||| ||| ||||||||||||||||||||||||||||||  |||  ||||||||    
37782051 ttagacatggtggttgggcctaactcaactccacaaaaccagcttgtgaggtgatgattgcccccacttataaacacattgtcagaccatcacctatccg 37782150  T
331 atgtgggactcttaaca 347  Q
    || || |||| ||||||    
37782151 atatgagactattaaca 37782167  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #48
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 240 - 343
Target Start/End: Complemental strand, 7369798 - 7369695
Alignment:
240 gtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggac 339  Q
    |||||||||||||||||||||||| ||||||||||| |||| |||||| ||||||||||||||||||| |  ||| | ||| || ||||| |||||||||    
7369798 gtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggactgcccccacttataaacacttgttcatgccatctcttatccaatgtgggac 7369699  T
340 tctt 343  Q
    ||||    
7369698 tctt 7369695  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #49
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 229 - 347
Target Start/End: Original strand, 24270105 - 24270223
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtc-ctat 327  Q
    ||||| |||| |||||||| | ||||||||||||| ||||||||||| |||| |||| ||| |||||||||||||| ||||||||||| ||||||  |||    
24270105 tcttaaaaatcgtggttggtc-taacacaaccccacaaaaccggcttgtgaggtgagtattacccccacttataaatacattgtcaggccatgtctttat 24270203  T
328 ccgatgtgggactcttaaca 347  Q
     |||||||||||||||||||    
24270204 tcgatgtgggactcttaaca 24270223  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #50
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 231 - 349
Target Start/End: Original strand, 29909722 - 29909841
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacaca-ttgtcaggtcatgtcctatcc 329  Q
    ||||||||||||||||||||||||||||| ||| ||||||||||| |||| ||||||||||| ||||||||||| | | ||||||   ||  ||||| |     
29909722 ttagaaatggtggttgggcctaacacaactccacaaaaccggcttgtgaggtgaggattgcctccacttataaaaaaaattgtcaaaccaactcctaact 29909821  T
330 gatgtgggactcttaacacc 349  Q
    ||||||||||||||||||||    
29909822 gatgtgggactcttaacacc 29909841  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #51
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 231 - 345
Target Start/End: Complemental strand, 8287884 - 8287771
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccg 330  Q
    |||||||| |||||||||||||||||||||||| ||||||||||| |||| || |||||| ||||||||||||||| |||| |||  ||  ||||| |||    
8287884 ttagaaattgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtggggattg-ccccacttataaacaaattgccagaccaactcctagccg 8287786  T
331 atgtgggactcttaa 345  Q
    ||||| |||||||||    
8287785 atgtgtgactcttaa 8287771  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #52
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 229 - 299
Target Start/End: Original strand, 25258093 - 25258163
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccactt 299  Q
    |||||||||| |||||||||||||||||||||||| ||||||||||| |||| ||||||||||||||||||    
25258093 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccactt 25258163  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #53
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 229 - 299
Target Start/End: Original strand, 25321883 - 25321953
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccactt 299  Q
    |||||||||| |||||||||||||||||||||||| ||||||||||| |||| ||||||||||||||||||    
25321883 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccactt 25321953  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #54
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 228 - 309
Target Start/End: Complemental strand, 60173 - 60092
Alignment:
228 ctcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacat 309  Q
    ||||||||||| ||| ||||| |||||| ||||||| ||||||||||| |||| ||||||||||||||||||||||||||||    
60173 ctcttagaaattgtgattgggtctaacataaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacacat 60092  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #55
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 253 - 341
Target Start/End: Original strand, 2061961 - 2062049
Alignment:
253 acacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggactc 341  Q
    |||||||| || || |||||||| |||| ||| ||||||||||||||||||||||||||||||| ||||| ||||||| ||||||||||    
2061961 acacaaccacacaagaccggcttgtgaggtgaagattgcccccacttataaacacattgtcaggccatgttctatccggtgtgggactc 2062049  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #56
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 235 - 347
Target Start/End: Complemental strand, 6637680 - 6637570
Alignment:
235 aaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgt 334  Q
    |||| |||||||||| ||| ||||||||  ||| ||||||| |||| |||||||| |||||||||||||||||||||||||| ||| ||||| |||||||    
6637680 aaatcgtggttgggcttaatacaaccccgcaaa-ccggcttgtgaggtgaggattacccccacttataaacacattgtcaggccatttcctaaccgatgt 6637582  T
335 gggactcttaaca 347  Q
     ||||||||||||    
6637581 -ggactcttaaca 6637570  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #57
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 229 - 348
Target Start/End: Original strand, 13700588 - 13700708
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    ||||||||||  || |||| | |||||||||| || ||||||||||| |||| |||| |||| ||  ||||||||||||||||||| ||||| |||||||    
13700588 tcttagaaatcatgattggacataacacaacctcacaaaaccggcttttgaggtgagaattgtccaaacttataaacacattgtcaagtcatctcctatc 13700687  T
329 cgat-gtgggactcttaacac 348  Q
    |||| ||||||||||||||||    
13700688 cgatggtgggactcttaacac 13700708  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #58
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 234 - 357
Target Start/End: Original strand, 29909491 - 29909615
Alignment:
234 gaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatg 333  Q
    |||||||||||| | |||||||||| |||| |||||||  || |||| ||||||||||| ||||||||||| | ||||||||| ||  ||||| ||||||    
29909491 gaaatggtggttagacctaacacaatcccacaaaaccgatttgtgaggtgaggattgcctccacttataaataaattgtcaggccaactcctaaccgatg 29909590  T
334 tgggactcttaacac-ccccctcac 357  Q
    | ||||||||||||| |||||||||    
29909591 tcggactcttaacacaccccctcac 29909615  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #59
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 265 - 348
Target Start/End: Original strand, 6919229 - 6919312
Alignment:
265 aaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggactcttaacac 348  Q
    ||||||||||| | || ||||||||||||||||| ||||||||||||||||||||| || |||  |||||||||||||||||||    
6919229 aaaaccggcttttaaggtgaggattgcccccactaataaacacattgtcaggtcatctcttatttgatgtgggactcttaacac 6919312  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #60
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 255 - 353
Target Start/End: Complemental strand, 8098610 - 8098512
Alignment:
255 acaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggactcttaacacccccc 353  Q
    ||||||||| ||||||||||| |||| ||||||||| |  | |||||||||| ||||||||| ||  ||||| ||||||||||||||||||||||||||    
8098610 acaaccccacaaaaccggcttgtgaggtgaggattgtctgcgcttataaacaaattgtcaggccaactcctaaccgatgtgggactcttaacacccccc 8098512  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #61
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 229 - 315
Target Start/End: Complemental strand, 15439072 - 15438986
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcag 315  Q
    ||||| |||| |||||| ||||||||||||||||||||||| | ||| |||| ||| ||||||||||||||||| ||||||||||||    
15439072 tcttataaatcgtggttaggcctaacacaaccccataaaactgacttgtgaggtgatgattgcccccacttatagacacattgtcag 15438986  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #62
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 265 - 347
Target Start/End: Original strand, 30770300 - 30770382
Alignment:
265 aaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggactcttaaca 347  Q
    |||||| |||| |||| ||||||||||||||||||||||||||||||||| | |||||||||||| | ||| |||||||||||    
30770300 aaaaccagcttatgaggtgaggattgcccccacttataaacacattgtcaagccatgtcctatccaaagtgagactcttaaca 30770382  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #63
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 229 - 331
Target Start/End: Original strand, 38731837 - 38731939
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||||||||||| ||||||||||||| || |||| || ||| |||| |||||||||  | ||||||||||||||||||||| |||| || ||||    
38731837 tcttagaaatggtggttgtgcctaacacaacctcacaaaatcgacttgtgaggtgaggattgttctcacttataaacacattgtcagatcatctcatatc 38731936  T
329 cga 331  Q
    |||    
38731937 cga 38731939  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #64
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 229 - 314
Target Start/End: Complemental strand, 13296757 - 13296673
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtca 314  Q
    |||||||||| |||||||||||||||||||||| | ||||| ||||| |||| ||||||||||||||||||||||| | |||||||    
13296757 tcttagaaatcgtggttgggcctaacacaaccc-acaaaactggcttgtgaggtgaggattgcccccacttataaataaattgtca 13296673  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #65
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 229 - 334
Target Start/End: Complemental strand, 38977018 - 38976913
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| ||||||| |||||||||| | ||| |||||||| || |||| ||||||||| ||| ||||||||||||||||||||   |||||||||     
38977018 tcttagaaatcgtggttgtgcctaacacacctccacaaaaccggtttgtgaggtgaggattgtcccaacttataaacacattgtcagacaatgtcctatt 38976919  T
329 cgatgt 334  Q
    ||||||    
38976918 cgatgt 38976913  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #66
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 248 - 348
Target Start/End: Original strand, 3859326 - 3859426
Alignment:
248 gcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggactcttaaca 347  Q
    |||||||| ||||||| ||||    ||| |||| ||||||||| || |||||||||||||||| ||||||||||| ||||||||| ||||||||||||||    
3859326 gcctaacataaccccacaaaattaacttgtgaggtgaggattgtcctcacttataaacacattatcaggtcatgttctatccgatatgggactcttaaca 3859425  T
348 c 348  Q
    |    
3859426 c 3859426  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #67
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 231 - 347
Target Start/End: Complemental strand, 7607677 - 7607561
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccg 330  Q
    ||||||||  ||||||||||||||||||| ||| ||||||||||| |||| ||| ||||| | ||||||||||||| |||||| || |||  ||||  ||    
7607677 ttagaaatcatggttgggcctaacacaactccacaaaaccggcttgtgaggtgaagattgtctccacttataaacagattgtcgggccataacctagtcg 7607578  T
331 atgtgggactcttaaca 347  Q
    ||||| |||||||||||    
7607577 atgtgagactcttaaca 7607561  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #68
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 234 - 338
Target Start/End: Original strand, 16707029 - 16707133
Alignment:
234 gaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatg 333  Q
    ||||| ||||||||||||||||||||||   |||||| |||| |||| | ||||||||||||||||||||||||||  ||||||||| |  ||||| |||    
16707029 gaaatcgtggttgggcctaacacaaccctgcaaaaccagcttgtgaggttaggattgcccccacttataaacacatgttcaggtcatattttatccaatg 16707128  T
334 tggga 338  Q
    |||||    
16707129 tggga 16707133  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #69
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 229 - 353
Target Start/End: Original strand, 33337237 - 33337361
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    ||||| |||| |||||||| | ||||||| |  || |||| ||| || |||| ||| ||||||||||||||||||||| ||||||||| |||  ||||||    
33337237 tcttaaaaatcgtggttggacttaacacagcttcacaaaatcggtttgtgaggtgatgattgcccccacttataaacatattgtcaggccatcacctatc 33337336  T
329 cgatgtgggactcttaacacccccc 353  Q
    | |||||||||||||||||| ||||    
33337337 caatgtgggactcttaacacacccc 33337361  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #70
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 231 - 315
Target Start/End: Original strand, 37656938 - 37657022
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcag 315  Q
    ||||| ||||||||||||||||||  ||||||| ||||||| ||| |||| | |||||| |||||||||||||||||||||||||    
37656938 ttagacatggtggttgggcctaacttaaccccacaaaaccgacttgtgaggtaaggattacccccacttataaacacattgtcag 37657022  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #71
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 242 - 309
Target Start/End: Original strand, 170563 - 170630
Alignment:
242 ggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacat 309  Q
    ||||||||||||||||||| || ||||||||||| |||| |||||| |||||||||||||||||||||    
170563 ggttgggcctaacacaacctcacaaaaccggcttgtgaggtgaggactgcccccacttataaacacat 170630  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #72
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 277 - 359
Target Start/End: Original strand, 17150280 - 17150363
Alignment:
277 tgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggactcttaacac-ccccctcacaa 359  Q
    |||| ||||||||||||||||||||||||||||| ||||  ||| ||||||||||||| | ||||||||||| |||||||||||    
17150280 tgaggtgaggattgcccccacttataaacacattttcagaccatctcctatccgatgttgaactcttaacacaccccctcacaa 17150363  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #73
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 231 - 357
Target Start/End: Complemental strand, 19522403 - 19522277
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccg 330  Q
    |||||||| ||||||| | |||||||||||||| |||| |||||| |||| |||  |||||||| ||||||||| | ||||||||  ||  ||||| |||    
19522403 ttagaaatcgtggttgtgtctaacacaaccccacaaaatcggcttgtgaggtgattattgcccc-acttataaataaattgtcagtccaactcctaaccg 19522305  T
331 atgtgggactcttaacac-ccccctcac 357  Q
    |||||||||||||||||| |||||||||    
19522304 atgtgggactcttaacacaccccctcac 19522277  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #74
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 231 - 334
Target Start/End: Complemental strand, 20225124 - 20225021
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccg 330  Q
    |||||||| |||||||  ||||||||||||||| |||| || ||| |||| ||||||||| || || ||||||||||| ||||||||||| | |||||||    
20225124 ttagaaatcgtggttgaacctaacacaaccccacaaaatcgacttgtgaggtgaggattgtcctcatttataaacacactgtcaggtcatcttctatccg 20225025  T
331 atgt 334  Q
    ||||    
20225024 atgt 20225021  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #75
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 282 - 348
Target Start/End: Original strand, 4481615 - 4481681
Alignment:
282 tgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggactcttaacac 348  Q
    ||||||||||||||| ||||||||||||||||||| ||  | |||||||||||||||||||||||||    
4481615 tgaggattgcccccatttataaacacattgtcaggccaacttctatccgatgtgggactcttaacac 4481681  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #76
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 241 - 335
Target Start/End: Complemental strand, 15438950 - 15438856
Alignment:
241 tggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtg 335  Q
    |||||| | |||||||||||| | |||| |||||| |||| ||||||||||||||||||||||||||||| ||||  ||| || |||||||||||    
15438950 tggttgagtctaacacaaccctagaaaatcggcttgtgaggtgaggattgcccccacttataaacacattatcagaccatctcatatccgatgtg 15438856  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #77
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 241 - 357
Target Start/End: Original strand, 17015890 - 17016003
Alignment:
241 tggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggact 340  Q
    ||||||||||||||||||||||| |||| |||||| |||| |||| ||||||| |||||||||||| |||||    || ||   ||||||||||||||||    
17015890 tggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagaattgccctcacttataaacatattgtacaatcttg---tatccgatgtgggact 17015986  T
341 cttaacacccccctcac 357  Q
    ||||||||  |||||||    
17015987 cttaacacaaccctcac 17016003  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #78
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 229 - 348
Target Start/End: Complemental strand, 18885548 - 18885428
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggct--tctgagatgaggattgcccccacttataaacacattgtcaggtcatgtccta 326  Q
    |||||||||||||||||| |||||||||||| ||| ||||| ||||  | |||| ||||| ||| | ||||||||||||||||||||||  ||| |  ||    
18885548 tcttagaaatggtggttgtgcctaacacaactccacaaaactggcttgtgtgaggtgagggttgtctccacttataaacacattgtcagaccatctttta 18885449  T
327 tccgatgtgggactcttaacac 348  Q
    | ||||||||||||||||||||    
18885448 t-cgatgtgggactcttaacac 18885428  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #79
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 231 - 316
Target Start/End: Complemental strand, 19522170 - 19522085
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcagg 316  Q
    |||||||| ||||||||| | || ||||||||| ||||||||||| |||| ||||||||||||||||| ||||||| |||| ||||    
19522170 ttagaaatcgtggttgggtcaaatacaaccccacaaaaccggcttgtgaggtgaggattgcccccactaataaacaaattgacagg 19522085  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #80
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 229 - 320
Target Start/End: Original strand, 2986011 - 2986102
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcat 320  Q
    |||||||||||||||||| |||||||||||||||| ||| ||  ||| | || |||| |||||||| |||||||||||| |||||| |||||    
2986011 tcttagaaatggtggttgagcctaacacaaccccacaaatccaacttgtaaggtgagaattgccccgacttataaacactttgtcatgtcat 2986102  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #81
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 244 - 357
Target Start/End: Complemental strand, 15590244 - 15590129
Alignment:
244 ttgggcctaacacaaccccataaaaccggcttctgagatgaggattgccc-ccacttataaacacattgtcaggtcatgtcctatccgatgtgggactct 342  Q
    |||||||||||||||||||| |||| | || | |||| |||||||||||| |||||||||||  |||||||||  ||| || ||| ||||||| ||||||    
15590244 ttgggcctaacacaaccccacaaaatcagcctgtgaggtgaggattgccctccacttataaatccattgtcagaccatctcatattcgatgtgagactct 15590145  T
343 taacac-ccccctcac 357  Q
    |||||| |||||||||    
15590144 taacacaccccctcac 15590129  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #82
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 241 - 348
Target Start/End: Complemental strand, 37405162 - 37405055
Alignment:
241 tggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggact 340  Q
    |||||||| |||| ||||||||| ||||||||||| |||| || |||||||||||||||| |||||| || ||||  ||| ||  | | |||||||||||    
37405162 tggttgggtctaatacaaccccacaaaaccggcttttgaggtggggattgcccccacttacaaacactttttcagaccatctctcaactgatgtgggact 37405063  T
341 cttaacac 348  Q
    ||||||||    
37405062 cttaacac 37405055  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #83
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 229 - 347
Target Start/End: Original strand, 6919428 - 6919544
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    ||||| |||| ||||||| ||||||||||||| || ||||| | ||| |||| |||| |||| |||||||||||||||||||||||  |||| || ||||    
6919428 tcttaaaaatcgtggttgagcctaacacaacctcacaaaactg-cttgtgaggtgagaattgtccccacttataaacacattgtca-atcatctcatatc 6919525  T
329 cgatgtgggactcttaaca 347  Q
    | ||||| |||||||||||    
6919526 ctatgtgagactcttaaca 6919544  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #84
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 230 - 347
Target Start/End: Original strand, 26137345 - 26137463
Alignment:
230 cttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttat-aaacacattgtcaggtcatgtcctatc 328  Q
    ||||||||| |||||||||||||||| || |||| ||||||  ||| |||||||||||||| | |||||||| ||| ||||||||||  ||| || ||||    
26137345 cttagaaatcgtggttgggcctaacataatcccacaaaaccaacttgtgagatgaggattgtcgccacttataaaaaacattgtcagaccatctcatatc 26137444  T
329 cgatgtgggactcttaaca 347  Q
    | || || |||||||||||    
26137445 caatatgagactcttaaca 26137463  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #85
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 242 - 343
Target Start/End: Complemental strand, 7092221 - 7092121
Alignment:
242 ggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggactc 341  Q
    |||||||||||||||||||||| ||||| ||||| |||| |||||||||||||||| | |||||||||  || || ||| |  ||||| |||||||||||    
7092221 ggttgggcctaacacaaccccacaaaactggcttgtgaggtgaggattgcccccac-tctaaacacatgttcgggccatctgttatccaatgtgggactc 7092123  T
342 tt 343  Q
    ||    
7092122 tt 7092121  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #86
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 292 - 353
Target Start/End: Complemental strand, 24528797 - 24528736
Alignment:
292 ccccacttataaacacattgtcaggtcatgtcctatccgatgtgggactcttaacacccccc 353  Q
    ||||||||||| ||||||||||||| |||||||| || ||||||||||||||||||| ||||    
24528797 ccccacttatatacacattgtcaggccatgtcctctcagatgtgggactcttaacacacccc 24528736  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #87
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 229 - 329
Target Start/End: Original strand, 16571459 - 16571559
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| || ||||| ||||||| ||||||| ||||||   || |||| |||||||| |||||||||| |||||||||||||| |||| | |||||    
16571459 tcttagaaatcgttgttggacctaacataaccccacaaaaccaatttatgaggtgaggatttcccccacttaaaaacacattgtcagatcatcttctatc 16571558  T
329 c 329  Q
    |    
16571559 c 16571559  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #88
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 229 - 345
Target Start/End: Original strand, 36040475 - 36040591
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    ||||||||||  |||||| |||||||||||||| |||||||   ||| |||| ||| ||||||  ||||||||||||||||| |||| |||| | |||||    
36040475 tcttagaaatcatggttgagcctaacacaaccctataaaacaaacttgtgaggtgatgattgcaaccacttataaacacattatcagatcatcttctatc 36040574  T
329 cgatgtgggactcttaa 345  Q
     ||||||  ||||||||    
36040575 tgatgtgaaactcttaa 36040591  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #89
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 229 - 311
Target Start/End: Complemental strand, 18140943 - 18140861
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattg 311  Q
    |||||||||| ||||||||| |||| |||| ||||||||||| | || |||  |||||||| ||||||| |||||||||||||    
18140943 tcttagaaatcgtggttgggtctaatacaatcccataaaaccagtttgtgaagtgaggattacccccacctataaacacattg 18140861  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #90
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 305 - 347
Target Start/End: Original strand, 38976873 - 38976915
Alignment:
305 cacattgtcaggtcatgtcctatccgatgtgggactcttaaca 347  Q
    |||||||||||||||||||||||| ||||||||||||||||||    
38976873 cacattgtcaggtcatgtcctatctgatgtgggactcttaaca 38976915  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #91
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 277 - 353
Target Start/End: Original strand, 2985275 - 2985352
Alignment:
277 tgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggactc-ttaacacccccc 353  Q
    |||| |||||||| |||||| |||||||||||||||||| |||| || ||||||| ||| ||||| ||||||||||||    
2985275 tgaggtgaggattacccccaattataaacacattgtcagatcatctcatatccgaggtgtgactctttaacacccccc 2985352  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #92
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 277 - 357
Target Start/End: Original strand, 11895963 - 11896043
Alignment:
277 tgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggactcttaacac-ccccctcac 357  Q
    |||||||| ||||||||| ||||||||| |||||||||||||||  ||||||| ||||  |||||||||||| |||||||||    
11895963 tgagatgatgattgcccc-acttataaatacattgtcaggtcatcacctatccaatgtaagactcttaacacaccccctcac 11896043  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #93
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 284 - 348
Target Start/End: Complemental strand, 13358431 - 13358367
Alignment:
284 aggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggactcttaacac 348  Q
    |||||| |||||||||||||||||||||||||   || ||||||| |||||| ||||||||||||    
13358431 aggattacccccacttataaacacattgtcagccaatctcctatctgatgtgagactcttaacac 13358367  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #94
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 277 - 345
Target Start/End: Original strand, 31181058 - 31181126
Alignment:
277 tgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggactcttaa 345  Q
    |||| ||| |||||||||||| |||||||| ||||||| |||||  |||||||||||||||| ||||||    
31181058 tgaggtgatgattgcccccacatataaacatattgtcaagtcatcacctatccgatgtgggaatcttaa 31181126  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #95
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 265 - 347
Target Start/End: Complemental strand, 37656662 - 37656582
Alignment:
265 aaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggactcttaaca 347  Q
    ||||||||||| |||  |||||||| |||  ||||||||||||||||||||  |||  ||||||||| |||||||||||||||    
37656662 aaaaccggcttgtgatgtgaggatttccc--acttataaacacattgtcagaccattacctatccgacgtgggactcttaaca 37656582  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #96
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 308 - 354
Target Start/End: Complemental strand, 26245989 - 26245943
Alignment:
308 attgtcaggtcatgtcctatccgatgtgggactcttaacacccccct 354  Q
    ||||||| ||||| ||||||||||||||||||||||||||| |||||    
26245989 attgtcatgtcatctcctatccgatgtgggactcttaacacacccct 26245943  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #97
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 266 - 347
Target Start/End: Original strand, 17017127 - 17017208
Alignment:
266 aaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggactcttaaca 347  Q
    |||||| ||| |||| ||| ||||| ||||||||||||||||||||||  | ||| | ||||| ||| ||||||||||||||    
17017127 aaaccgacttgtgaggtgatgattgaccccacttataaacacattgtcgagccatcttctatctgatatgggactcttaaca 17017208  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #98
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 244 - 309
Target Start/End: Original strand, 17899474 - 17899539
Alignment:
244 ttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacat 309  Q
    ||||||||||| || || || |||| |||||  |||| ||||||||||||||||||||||||||||    
17899474 ttgggcctaactcatcctcacaaaatcggctcatgaggtgaggattgcccccacttataaacacat 17899539  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #99
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 231 - 263
Target Start/End: Original strand, 1028399 - 1028431
Alignment:
231 ttagaaatggtggttgggcctaacacaacccca 263  Q
    |||||||||||||||||||||||||||||||||    
1028399 ttagaaatggtggttgggcctaacacaacccca 1028431  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #100
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 277 - 345
Target Start/End: Original strand, 11896732 - 11896800
Alignment:
277 tgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggactcttaa 345  Q
    |||| ||| |||||||||||||||| |||||||| ||| |||||   |||||||||||| |||||||||    
11896732 tgaggtgatgattgcccccacttattaacacattatcaagtcattatctatccgatgtgcgactcttaa 11896800  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #101
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 249 - 348
Target Start/End: Complemental strand, 17584238 - 17584139
Alignment:
249 cctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggactcttaacac 348  Q
    ||||||||||| ||| ||||||| ||| | |  ||||||||||||| || ||||||||||| |  |  |||| ||||||| |||| ||||||||||||||    
17584238 cctaacacaactccacaaaaccgacttgtaaagtgaggattgccccaacatataaacacatcgataactcatctcctatctgatgggggactcttaacac 17584139  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #102
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 231 - 290
Target Start/End: Original strand, 21209709 - 21209768
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattg 290  Q
    |||||||| ||||||| || ||||||||||||| ||||||||||| |||| |||| ||||    
21209709 ttagaaatcgtggttgtgcttaacacaaccccacaaaaccggcttgtgaggtgagaattg 21209768  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #103
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 231 - 306
Target Start/End: Complemental strand, 34328994 - 34328919
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaaca 306  Q
    |||||||| ||| ||||||||||||||||  || ||||||||||| ||||||||  |||||  | |||||||||||    
34328994 ttagaaatcgtgattgggcctaacacaacttcacaaaaccggcttgtgagatgaatattgcttctacttataaaca 34328919  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #104
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 243 - 343
Target Start/End: Complemental strand, 7104338 - 7104239
Alignment:
243 gttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccact-tataaacacattgtcaggtcatgtcctatccgatgtgggactc 341  Q
    ||||||||||||||  ||||| |||||||| || ||   ||||||||||| ||||| | |||||||||  | ||||||| | ||||||||||||||||||    
7104338 gttgggcctaacacgtccccacaaaaccggtttgtgg--tgaggattgcctccactctctaaacacatgtttaggtcatctgctatccgatgtgggactc 7104241  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #105
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 241 - 291
Target Start/End: Complemental strand, 31974289 - 31974239
Alignment:
241 tggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgc 291  Q
    ||||||||||||||||||||||| ||||| ||||| || | ||||||||||    
31974289 tggttgggcctaacacaaccccacaaaactggcttgtgcggtgaggattgc 31974239  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #106
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 245 - 307
Target Start/End: Complemental strand, 31974505 - 31974443
Alignment:
245 tgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacac 307  Q
    ||||||||||||||||  | ||||| ||||  |||| |||||| |||||||||||||||||||    
31974505 tgggcctaacacaaccttacaaaactggctcgtgaggtgaggactgcccccacttataaacac 31974443  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #107
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 256 - 309
Target Start/End: Complemental strand, 25436259 - 25436206
Alignment:
256 caaccccataaaaccggcttctgagatgaggattgcccccacttataaacacat 309  Q
    |||||||| ||||||||||| |||| |||||||| |||  ||||||||||||||    
25436259 caaccccacaaaaccggcttgtgaggtgaggatttcccttacttataaacacat 25436206  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #108
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 229 - 281
Target Start/End: Complemental strand, 9187371 - 9187319
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgaga 281  Q
    |||||||||| ||||||| | |||||||||||||| |||| |||||| |||||    
9187371 tcttagaaatcgtggttgagtctaacacaaccccacaaaatcggcttgtgaga 9187319  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0519 (Bit Score: 98; Significance: 3e-48; HSPs: 2)
Name: scaffold0519
Description:

Target: scaffold0519; HSP #1
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 229 - 357
Target Start/End: Complemental strand, 2236 - 2107
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    ||||||||||||||||||||||||||||||||||| ||||||||||| | || ||||||||||||||||||||||||||||||||||| |||||||| ||    
2236 tcttagaaatggtggttgggcctaacacaaccccacaaaaccggcttgtaaggtgaggattgcccccacttataaacacattgtcaggccatgtcctgtc 2137  T
329 cgatgtgggactcttaacac-ccccctcac 357  Q
    |||||||||||||||||||| |||||||||    
2136 cgatgtgggactcttaacacaccccctcac 2107  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0519; HSP #2
Raw Score: 91; E-Value: 5e-44
Query Start/End: Original strand, 229 - 347
Target Start/End: Complemental strand, 2001 - 1883
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    ||||||||||||||||||||||||||||||||||| ||||||||||| | || ||||||||||||||||||||||||||||||||||  |||||||| ||    
2001 tcttagaaatggtggttgggcctaacacaaccccacaaaaccggcttgtaaggtgaggattgcccccacttataaacacattgtcagaccatgtcctgtc 1902  T
329 cgatgtgggactcttaaca 347  Q
    |||||||||||||||||||    
1901 cgatgtgggactcttaaca 1883  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 98; Significance: 3e-48; HSPs: 124)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 229 - 357
Target Start/End: Original strand, 11232193 - 11232322
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    ||||||||||||||||||||||||||||||||||| ||||||||||| | || ||||||||||||||||||||||||||||||||||| |||||||| ||    
11232193 tcttagaaatggtggttgggcctaacacaaccccacaaaaccggcttgtaaggtgaggattgcccccacttataaacacattgtcaggccatgtcctgtc 11232292  T
329 cgatgtgggactcttaacac-ccccctcac 357  Q
    |||||||||||||||||||| |||||||||    
11232293 cgatgtgggactcttaacacaccccctcac 11232322  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 91; E-Value: 5e-44
Query Start/End: Original strand, 229 - 347
Target Start/End: Original strand, 11232428 - 11232546
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    ||||||||||||||||||||||||||||||||||| ||||||||||| | || ||||||||||||||||||||||||||||||||||  |||||||| ||    
11232428 tcttagaaatggtggttgggcctaacacaaccccacaaaaccggcttgtaaggtgaggattgcccccacttataaacacattgtcagaccatgtcctgtc 11232527  T
329 cgatgtgggactcttaaca 347  Q
    |||||||||||||||||||    
11232528 cgatgtgggactcttaaca 11232546  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 91; E-Value: 5e-44
Query Start/End: Original strand, 228 - 357
Target Start/End: Complemental strand, 39960278 - 39960148
Alignment:
228 ctcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgc-ccccacttataaacacattgtcaggtcatgtccta 326  Q
    ||||||||||| |||||||||||||||||||||||| ||||||||||| |||| |||||||||| ||||||||||||||| ||| ||||| ||| |||||    
39960278 ctcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaattttcaggccatctccta 39960179  T
327 tccgatgtgggactcttaacacccccctcac 357  Q
    |||||||||||||||||||||||||||||||    
39960178 tccgatgtgggactcttaacacccccctcac 39960148  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 229 - 357
Target Start/End: Original strand, 35682780 - 35682909
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| |||||||||||||||||||||||| |||||||||||  ||| ||||||||||||||||||||||||||||||||||| |||||||| ||    
35682780 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgcgaggtgaggattgcccccacttataaacacattgtcaggccatgtcctgtc 35682879  T
329 cgatgtgggactcttaacacc-cccctcac 357  Q
    |||||||| |||||||||||| ||||||||    
35682880 cgatgtggaactcttaacaccacccctcac 35682909  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 229 - 348
Target Start/End: Original strand, 5931948 - 5932067
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    ||||| ||||||||||||||||||||| ||||||| ||||||||||| |||| ||||||||||||||||||||||||||||||||||| ||||| |||||    
5931948 tcttaaaaatggtggttgggcctaacataaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacacattgtcaggccatgtactatc 5932047  T
329 cgatgtgggactcttaacac 348  Q
     |||||||||||||||||||    
5932048 tgatgtgggactcttaacac 5932067  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 228 - 347
Target Start/End: Complemental strand, 10450086 - 10449967
Alignment:
228 ctcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctat 327  Q
    ||||||||||| ||||||| |||||||||||||| | |||||||||||||||| |||||||||||| |||||||||||||||||||||| ||||||||||    
10450086 ctcttagaaatcgtggttgagcctaacacaaccctacaaaaccggcttctgaggtgaggattgcccacacttataaacacattgtcaggccatgtcctat 10449987  T
328 ccgatgtgggactcttaaca 347  Q
    |||||||| |||||||||||    
10449986 ccgatgtgagactcttaaca 10449967  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 229 - 347
Target Start/End: Original strand, 24532420 - 24532538
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    ||||||||||  ||||||||||||||||||||||| ||||||||||| |||| ||| ||||||||||||||||||||||||||||||| ||| |||||||    
24532420 tcttagaaatcatggttgggcctaacacaaccccacaaaaccggcttgtgaggtgatgattgcccccacttataaacacattgtcaggccatctcctatc 24532519  T
329 cgatgtgggactcttaaca 347  Q
    |||||||||||||||||||    
24532520 cgatgtgggactcttaaca 24532538  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 229 - 347
Target Start/End: Original strand, 39052928 - 39053046
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| || ||||||||||||||||||||| ||||||||||| |||| ||||||||||||||||||||||||||||||||||| |||  ||||||    
39052928 tcttagaaatcgttgttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacacattgtcaggccatcacctatc 39053027  T
329 cgatgtgggactcttaaca 347  Q
    |||||||||||||||||||    
39053028 cgatgtgggactcttaaca 39053046  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 84; E-Value: 8e-40
Query Start/End: Original strand, 231 - 357
Target Start/End: Original strand, 19256587 - 19256714
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccg 330  Q
    |||||||| |||||||||||||||||||||||| ||||||||||| |||| ||||||||||||||||||||||||| ||||||||| ||  ||||| |||    
19256587 ttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcaggccaactcctaaccg 19256686  T
331 atgtgggactcttaacac-ccccctcac 357  Q
    |||||||||||||||||| |||||||||    
19256687 atgtgggactcttaacacaccccctcac 19256714  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 231 - 357
Target Start/End: Complemental strand, 17477148 - 17477021
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccg 330  Q
    |||||||| ||||||| |||||||||||||||| ||||||||||| |||| ||||||||||||||||||||||||| ||||||||| ||  ||||| |||    
17477148 ttagaaatcgtggttgagcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcaggccaactcctaaccg 17477049  T
331 atgtgggactcttaacac-ccccctcac 357  Q
    |||||||||||||||||| |||||||||    
17477048 atgtgggactcttaacacaccccctcac 17477021  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 79; E-Value: 8e-37
Query Start/End: Original strand, 229 - 347
Target Start/End: Complemental strand, 12317131 - 12317013
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| ||||||||||||||||||| |||| |||| | |||| |||| ||||||||||||||||||||||||||||||||||  |||||||| ||    
12317131 tcttagaaatcgtggttgggcctaacacaatcccacaaaatcagcttatgaggtgaggattgcccccacttataaacacattgtcagaccatgtcctgtc 12317032  T
329 cgatgtgggactcttaaca 347  Q
    |||||||||||||||||||    
12317031 cgatgtgggactcttaaca 12317013  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 231 - 347
Target Start/End: Complemental strand, 17469901 - 17469785
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccg 330  Q
    |||||||| ||||||| |||||||||||||||| ||||||||||| |||| ||||||||||||||||||||||||| ||||||||| ||  ||||| |||    
17469901 ttagaaatcgtggttgagcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcaggccaactcctaaccg 17469802  T
331 atgtgggactcttaaca 347  Q
    |||||||||||||||||    
17469801 atgtgggactcttaaca 17469785  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #13
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 231 - 347
Target Start/End: Original strand, 19256821 - 19256937
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccg 330  Q
    |||||||| |||||||||||||||||||||||| |||||| |||| |||| ||||||||||||||||||||||||| ||||||||| ||  ||||| |||    
19256821 ttagaaatcgtggttgggcctaacacaaccccacaaaacctgcttgtgaggtgaggattgcccccacttataaacaaattgtcaggccaactcctaaccg 19256920  T
331 atgtgggactcttaaca 347  Q
    |||||||||||||||||    
19256921 atgtgggactcttaaca 19256937  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #14
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 231 - 347
Target Start/End: Original strand, 24075307 - 24075423
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccg 330  Q
    |||||||| |||||||||||||||||||||||| ||||||||||| |||| ||||||||||||||||||||||||| | ||||||| ||  ||||| |||    
24075307 ttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacaaagtgtcaggccaactcctaaccg 24075406  T
331 atgtgggactcttaaca 347  Q
    |||||||||||||||||    
24075407 atgtgggactcttaaca 24075423  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #15
Raw Score: 76; E-Value: 5e-35
Query Start/End: Original strand, 229 - 340
Target Start/End: Original strand, 5932183 - 5932294
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    ||||| ||||||||||||||||||||||||||||| ||||| ||||| |||| ||||| ||||||||||||||||||||||||| ||  |||||||||||    
5932183 tcttaaaaatggtggttgggcctaacacaaccccacaaaacaggcttgtgaggtgaggcttgcccccacttataaacacattgttagaccatgtcctatc 5932282  T
329 cgatgtgggact 340  Q
    ||||||||||||    
5932283 cgatgtgggact 5932294  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #16
Raw Score: 76; E-Value: 5e-35
Query Start/End: Original strand, 229 - 348
Target Start/End: Original strand, 15042669 - 15042788
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| ||||||| |||||||||||||||| |||| ||| ||  ||| ||| ||||||||||||||||||||||||||||||| |||||| ||||    
15042669 tcttagaaatcgtggttgagcctaacacaaccccacaaaatcggtttgcgaggtgatgattgcccccacttataaacacattgtcaggccatgtcgtatc 15042768  T
329 cgatgtgggactcttaacac 348  Q
    ||||||||||||||||||||    
15042769 cgatgtgggactcttaacac 15042788  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #17
Raw Score: 76; E-Value: 5e-35
Query Start/End: Original strand, 229 - 352
Target Start/End: Original strand, 18004095 - 18004218
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    ||||||||||  |||||||||||||||||||| || ||||||| ||| || | ||||||||||||||||||||||||| ||||||||| |||||||| ||    
18004095 tcttagaaatcttggttgggcctaacacaacctcacaaaaccgacttatggggtgaggattgcccccacttataaacatattgtcaggccatgtcctgtc 18004194  T
329 cgatgtgggactcttaacaccccc 352  Q
     |||||||||||||||||||||||    
18004195 tgatgtgggactcttaacaccccc 18004218  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #18
Raw Score: 76; E-Value: 5e-35
Query Start/End: Original strand, 231 - 357
Target Start/End: Complemental strand, 39743612 - 39743485
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccg 330  Q
    |||||||| |||||||||||||||||||||||| |||| |||||| |||| ||||||||||||| ||||||||||| ||||||||| ||  ||||| |||    
39743612 ttagaaatcgtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgaggattgccccaacttataaacaaattgtcaggccaactcctaaccg 39743513  T
331 atgtgggactcttaacac-ccccctcac 357  Q
    |||||||||||||||||| |||||||||    
39743512 atgtgggactcttaacacaccccctcac 39743485  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #19
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 229 - 347
Target Start/End: Complemental strand, 25325731 - 25325613
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| |||||||||||||| ||||| ||| ||||| ||||| ||||  ||||||||| |||||||||||||||||||| ||| |||||||||||    
25325731 tcttagaaatcgtggttgggcctaaaacaactccacaaaactggcttgtgaggagaggattgcacccacttataaacacattgttaggccatgtcctatc 25325632  T
329 cgatgtgggactcttaaca 347  Q
    |||||||||||||||||||    
25325631 cgatgtgggactcttaaca 25325613  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #20
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 231 - 347
Target Start/End: Original strand, 5590369 - 5590485
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccg 330  Q
    |||||||| ||||||||||||||||||||| || ||||||||||| |||  |||||||||||||||||| |||||||||||||||  ||| |||||||||    
5590369 ttagaaattgtggttgggcctaacacaacctcacaaaaccggcttgtgaagtgaggattgcccccacttgtaaacacattgtcagaccatctcctatccg 5590468  T
331 atgtgggactcttaaca 347  Q
    |||||||||||| ||||    
5590469 atgtgggactctgaaca 5590485  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #21
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 229 - 349
Target Start/End: Complemental strand, 41790743 - 41790624
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| |||||||||||||||||||||| | ||||||||||| |||| ||||||||| |||||||||||||||||||||||||||||  |||||     
41790743 tcttagaaatcgtggttgggcctaacacaaccc-acaaaaccggcttatgaggtgaggattgtccccacttataaacacattgtcaggtcatcacctatt 41790645  T
329 cgatgtgggactcttaacacc 349  Q
    |||||||| ||| ||||||||    
41790644 cgatgtggaacttttaacacc 41790624  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #22
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 232 - 343
Target Start/End: Complemental strand, 4828375 - 4828264
Alignment:
232 tagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccga 331  Q
    ||||||| |||||||||||||||||||||||| ||||||||||| |||| ||||||||||||||||||||||||| ||||||| | ||  ||||| ||||    
4828375 tagaaattgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcatgccaactcctaaccga 4828276  T
332 tgtgggactctt 343  Q
    ||||||||||||    
4828275 tgtgggactctt 4828264  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #23
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 229 - 347
Target Start/End: Original strand, 42846604 - 42846723
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgccc-ccacttataaacacattgtcaggtcatgtcctat 327  Q
    |||||||||| |||||||||||||||||||||||| ||||||||||| |||| |||||||||||| ||||||||||||| ||||||||| ||  |||||     
42846604 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgccctccacttataaacaaattgtcaggccaactcctaa 42846703  T
328 ccgatgtgggactcttaaca 347  Q
    |||||||| |||||||||||    
42846704 ccgatgtgagactcttaaca 42846723  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #24
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 229 - 343
Target Start/End: Complemental strand, 37001549 - 37001435
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| |||||||||||||||||||||||| ||||||||||| |||  ||||||||| |||||||||||||||| |||||||| ||| |||| ||    
37001549 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgatgtgaggattgtccccacttataaacactttgtcaggccatttcctgtc 37001450  T
329 cgatgtgggactctt 343  Q
    ||||||| |||||||    
37001449 cgatgtgagactctt 37001435  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #25
Raw Score: 69; E-Value: 7e-31
Query Start/End: Original strand, 231 - 355
Target Start/End: Original strand, 422218 - 422342
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccg 330  Q
    |||||||| |||||| ||||||||| ||||||| ||||| ||||| |||| ||||||||||| |||||| |||||||||||||||  ||| |||||||||    
422218 ttagaaatcgtggtttggcctaacataaccccacaaaactggcttgtgaggtgaggattgcctccacttttaaacacattgtcagaccatctcctatccg 422317  T
331 atgtgggactcttaacacccccctc 355  Q
    |||||||||| ||||||| ||||||    
422318 atgtgggacttttaacacacccctc 422342  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #26
Raw Score: 69; E-Value: 7e-31
Query Start/End: Original strand, 231 - 343
Target Start/End: Complemental strand, 4828151 - 4828039
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccg 330  Q
    ||||| || |||||||||||||||||||||||| ||||||||||| |||| ||||||||| ||||||||||||||| ||||||| ||||  ||||| |||    
4828151 ttagagatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgtccccacttataaacaaattgtcatgtcaactcctaaccg 4828052  T
331 atgtgggactctt 343  Q
    |||||||||||||    
4828051 atgtgggactctt 4828039  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #27
Raw Score: 69; E-Value: 7e-31
Query Start/End: Original strand, 229 - 353
Target Start/End: Complemental strand, 12688392 - 12688268
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    ||||||||||  ||||||| |||| |||||||||| ||||| ||||| |||| | ||||||||||||||||||||||||||||||||||||| | |||||    
12688392 tcttagaaatcatggttggacctatcacaaccccacaaaactggcttgtgaggtaaggattgcccccacttataaacacattgtcaggtcatcttctatc 12688293  T
329 cgatgtgggactcttaacacccccc 353  Q
    | |||||||||||||| ||| ||||    
12688292 caatgtgggactcttatcacacccc 12688268  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #28
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 229 - 347
Target Start/End: Original strand, 3157558 - 3157677
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattg-cccccacttataaacacattgtcaggtcatgtcctat 327  Q
    ||||| |||||||||||| |||||||||||||||| ||||| ||||| |||| ||||||||| |||||||||||||| |||||| |||| |||  |||||    
3157558 tcttataaatggtggttgagcctaacacaaccccacaaaactggcttgtgaggtgaggattgccccccacttataaatacattgccaggccatcacctat 3157657  T
328 ccgatgtgggactcttaaca 347  Q
    ||||||||||||||||||||    
3157658 ccgatgtgggactcttaaca 3157677  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #29
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 229 - 348
Target Start/End: Complemental strand, 20301346 - 20301227
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| ||||||||||||||||||||| || ||||| ||||| |||| | ||||||||||||||||||||||||||||||| | ||| || ||||    
20301346 tcttagaaatcgtggttgggcctaacacaacctcacaaaacgggcttgtgaggttaggattgcccccacttataaacacattgtcaagccatctcatatc 20301247  T
329 cgatgtgggactcttaacac 348  Q
    | |||||| |||||||||||    
20301246 caatgtggtactcttaacac 20301227  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #30
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 229 - 348
Target Start/End: Complemental strand, 21087978 - 21087859
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| ||||||||||||||||||||| || ||||| ||||| |||| | ||||||||||||||||||||||||||||||| | ||| || ||||    
21087978 tcttagaaatcgtggttgggcctaacacaacctcacaaaacgggcttgtgaggttaggattgcccccacttataaacacattgtcaagccatctcatatc 21087879  T
329 cgatgtgggactcttaacac 348  Q
    | |||||| |||||||||||    
21087878 caatgtggtactcttaacac 21087859  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #31
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 229 - 347
Target Start/End: Original strand, 35385810 - 35385929
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattg-cccccacttataaacacattgtcaggtcatgtcctat 327  Q
    |||||||||||||||||| || ||||||||||||| ||||||||||| |||| ||||||||| |||||||||||||||| ||| |||||  || | ||||    
35385810 tcttagaaatggtggttgagcttaacacaaccccacaaaaccggcttatgaggtgaggattgccccccacttataaacatattatcaggctatcttctat 35385909  T
328 ccgatgtgggactcttaaca 347  Q
    ||||||||||||||||||||    
35385910 ccgatgtgggactcttaaca 35385929  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #32
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 230 - 340
Target Start/End: Complemental strand, 8929101 - 8928991
Alignment:
230 cttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatcc 329  Q
    ||||||| | |||||||||||||||||||||||| ||||||||||| |||| || |||||||||||| ||||||||||||||||||| ||| || |||||    
8929101 cttagaattcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgcggattgcccccagttataaacacattgtcaggccatctcatatcc 8929002  T
330 gatgtgggact 340  Q
    ||||| |||||    
8929001 gatgtcggact 8928991  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #33
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 245 - 343
Target Start/End: Original strand, 38447442 - 38447540
Alignment:
245 tgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggactctt 343  Q
    ||||||||||||||||||| ||||||||||| |||| ||||||||||||||||||||||||||||||||||| ||| || |||||| ||||||| ||||    
38447442 tgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacacattgtcaggccatctcttatccgttgtgggattctt 38447540  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #34
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 231 - 348
Target Start/End: Original strand, 28069358 - 28069475
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccg 330  Q
    |||||||| ||||||||  |||||||||| ||| |||| | | || |||| ||||||||||||||||||||||| ||||||||||| |||||| ||||||    
28069358 ttagaaatcgtggttggatctaacacaactccacaaaatcagtttgtgaggtgaggattgcccccacttataaatacattgtcaggccatgtcatatccg 28069457  T
331 atgtgggactcttaacac 348  Q
    ||||||||||||||||||    
28069458 atgtgggactcttaacac 28069475  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #35
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 231 - 347
Target Start/End: Original strand, 7267466 - 7267582
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccg 330  Q
    |||||||||||||||||| |||||||||||| | ||||||||||| |||| ||| ||||||||||||||||||||| ||||||| | ||  ||||| |||    
7267466 ttagaaatggtggttgggtctaacacaaccctacaaaaccggcttgtgaggtgatgattgcccccacttataaacaaattgtcaagccaactcctaaccg 7267565  T
331 atgtgggactcttaaca 347  Q
    ||||| |||||||||||    
7267566 atgtgtgactcttaaca 7267582  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #36
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 231 - 347
Target Start/End: Complemental strand, 34842761 - 34842645
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccg 330  Q
    |||||||| ||||||| |||||||||||||||| ||||||| | | |||| ||||||||||||||||||||||||| ||||||||| ||  ||||| | |    
34842761 ttagaaatcgtggttgagcctaacacaaccccacaaaaccgacctatgaggtgaggattgcccccacttataaacaaattgtcaggccaactcctaactg 34842662  T
331 atgtgggactcttaaca 347  Q
    |||||||||||||||||    
34842661 atgtgggactcttaaca 34842645  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #37
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 228 - 348
Target Start/End: Original strand, 3157325 - 3157442
Alignment:
228 ctcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattg-cccccacttataaacacattgtcaggtcatgtccta 326  Q
    |||||||||||||||||||||||||||||||||||| |||| | |||| |||| ||||||||| |||||||||||||||||||||||||| ||   ||||    
3157325 ctcttagaaatggtggttgggcctaacacaaccccacaaaa-cagcttgtgaggtgaggattgccccccacttataaacacattgtcaggcca---ccta 3157420  T
327 tccgatgtgggactcttaacac 348  Q
    ||| ||||| ||||||||||||    
3157421 tcccatgtgagactcttaacac 3157442  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #38
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 229 - 343
Target Start/End: Original strand, 22638178 - 22638292
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| |||||||||| ||||||||||||| ||||||||||| || | ||||||||||||| |||||||||||| ||| |||| ||| || ||||    
22638178 tcttagaaatcgtggttgggcttaacacaaccccacaaaaccggcttgtgtggtgaggattgcccctacttataaacactttgacaggccatctcttatc 22638277  T
329 cgatgtgggactctt 343  Q
    ||||||| |||||||    
22638278 cgatgtgagactctt 22638292  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #39
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 227 - 348
Target Start/End: Complemental strand, 12547185 - 12547065
Alignment:
227 tctcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtccta 326  Q
    |||||||||||| || ||||||||||||||||||||| ||||||||||| |||| ||| ||||| ||||||||||||| | ||||||||  ||  |||||    
12547185 tctcttagaaatcgtagttgggcctaacacaaccccacaaaaccggcttgtgaggtgaagattg-ccccacttataaataaattgtcagaccaactccta 12547087  T
327 tccgatgtgggactcttaacac 348  Q
     |||||||||||||||||||||    
12547086 accgatgtgggactcttaacac 12547065  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #40
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 227 - 303
Target Start/End: Complemental strand, 27205247 - 27205171
Alignment:
227 tctcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataa 303  Q
    |||||||||||| |||||||||||||||||||||||| ||||||||||| |||| ||||||||||||||||||||||    
27205247 tctcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttatgaggtgaggattgcccccacttataa 27205171  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #41
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 229 - 340
Target Start/End: Complemental strand, 8084212 - 8084101
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| ||||||||| |||||||||| ||  |||||| |||| |||| ||||||||||||||||||||||| ||||||||||   ||||||| ||    
8084212 tcttagaaatcgtggttgggtctaacacaactccgcaaaaccagcttgtgaggtgaggattgcccccacttataaatacattgtcagactatgtcctgtc 8084113  T
329 cgatgtgggact 340  Q
    ||||||||||||    
8084112 cgatgtgggact 8084101  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #42
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 228 - 357
Target Start/End: Complemental strand, 8084448 - 8084318
Alignment:
228 ctcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctat 327  Q
    ||||||||||| |||||||| |||||||||||| || ||||| || || |||| ||||| || |||||||||||||| ||||||| ||| |||||| | |    
8084448 ctcttagaaatcgtggttggacctaacacaacctcacaaaactggtttgtgaggtgaggtttacccccacttataaatacattgttaggccatgtcttgt 8084349  T
328 ccgatgtgggactcttaacac-ccccctcac 357  Q
     |||||||||||||||||||| |||||||||    
8084348 tcgatgtgggactcttaacacaccccctcac 8084318  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #43
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 232 - 342
Target Start/End: Original strand, 26800514 - 26800624
Alignment:
232 tagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccga 331  Q
    ||||||| |||||||||||||||||||||||| ||||||||||| || | ||||||||||||||||||||| ||| ||| ||||| ||  | ||| ||||    
26800514 tagaaattgtggttgggcctaacacaaccccacaaaaccggcttgtgtggtgaggattgcccccacttatagacaaattatcaggccaacttctaaccga 26800613  T
332 tgtgggactct 342  Q
    |||||||||||    
26800614 tgtgggactct 26800624  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #44
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 229 - 303
Target Start/End: Complemental strand, 27205049 - 27204975
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataa 303  Q
    |||||||||| |||||||||||||||||||||||| ||||||||||| |||| ||||||||||||||||||||||    
27205049 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttatgaggtgaggattgcccccacttataa 27204975  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #45
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 229 - 303
Target Start/End: Complemental strand, 27205147 - 27205073
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataa 303  Q
    |||||||||| |||||||||||||||||||||||| ||||||||||| |||| ||||||||||||||||||||||    
27205147 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttatgaggtgaggattgcccccacttataa 27205073  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #46
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 229 - 347
Target Start/End: Original strand, 36917438 - 36917556
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||||||||||| || ||||||||||||| ||||| | ||| |||  |||||||| |||||||||||||| ||||||||||| |||  ||||||    
36917438 tcttagaaatggtggttgtgcttaacacaaccccacaaaactgacttgtgatgtgaggattacccccacttataaatacattgtcaggccattacctatc 36917537  T
329 cgatgtgggactcttaaca 347  Q
     |||||| |||||||||||    
36917538 tgatgtgagactcttaaca 36917556  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #47
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 229 - 316
Target Start/End: Complemental strand, 10884149 - 10884062
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattg-cccccacttataaacacattgtcagg 316  Q
    |||||||||| ||||||||||||||||||| |||| ||||||||||| |||| ||||||||| ||||||||||||||||||||||||||    
10884149 tcttagaaatcgtggttgggcctaacacaa-cccacaaaaccggcttgtgaggtgaggattgccccccacttataaacacattgtcagg 10884062  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #48
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 250 - 353
Target Start/End: Complemental strand, 34843181 - 34843078
Alignment:
250 ctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggactcttaacacc 349  Q
    |||||||||||||| ||||||||||| |||| |||||||||| |||||||||||||| ||||| ||  ||  ||||| |||||||||||||||||||||     
34843181 ctaacacaaccccacaaaaccggcttgtgaggtgaggattgctcccacttataaacaaattgttagaccaactcctaaccgatgtgggactcttaacaca 34843082  T
350 cccc 353  Q
    ||||    
34843081 cccc 34843078  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #49
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 228 - 306
Target Start/End: Original strand, 18939295 - 18939373
Alignment:
228 ctcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaaca 306  Q
    ||||||||||||||||||||||||||||||||| || |||| | |||| |||| |||||||||||||||||||||||||    
18939295 ctcttagaaatggtggttgggcctaacacaacctcacaaaatcagcttgtgaggtgaggattgcccccacttataaaca 18939373  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #50
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 250 - 347
Target Start/End: Complemental strand, 20702861 - 20702763
Alignment:
250 ctaacacaaccccataaaaccggcttctgagatgaggattgc-ccccacttataaacacattgtcaggtcatgtcctatccgatgtgggactcttaaca 347  Q
    ||||||||||| || ||||||||||| ||||||||||||||| ||||||||||||||| | ||||||| ||  ||||| ||||||||||||||||||||    
20702861 ctaacacaacctcacaaaaccggcttatgagatgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcttaaca 20702763  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #51
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 229 - 335
Target Start/End: Complemental strand, 29005949 - 29005843
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| ||||||||| ||||||||||| ||||||  |||||| |||  |||||||||  |||||||||||||| ||||||||||||| |||||||    
29005949 tcttagaaatcgtggttgggtctaacacaacctcataaattcggcttatgaagtgaggattgttcccacttataaacatattgtcaggtcatctcctatc 29005850  T
329 cgatgtg 335  Q
    | |||||    
29005849 caatgtg 29005843  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #52
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 229 - 343
Target Start/End: Complemental strand, 37001311 - 37001197
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||| ||||| |||||||||||||||||||| ||| ||||||||||| |||| |||||||||||||||| ||||||||| |||| ||| ||| ||   |     
37001311 tctttgaaatcgtggttgggcctaacacaactccacaaaaccggcttgtgaggtgaggattgcccccacctataaacactttgtgaggccatctctcgtt 37001212  T
329 cgatgtgggactctt 343  Q
    |||||||||||||||    
37001211 cgatgtgggactctt 37001197  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #53
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 229 - 307
Target Start/End: Complemental strand, 38475832 - 38475754
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacac 307  Q
    |||||||| | |||||||||||||||||||||| | ||||||||||| |||| ||||||||||||||||||||||||||    
38475832 tcttagaatttgtggttgggcctaacacaaccctacaaaaccggcttgtgaggtgaggattgcccccacttataaacac 38475754  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #54
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 231 - 348
Target Start/End: Complemental strand, 34653233 - 34653117
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccg 330  Q
    |||||||| |||||||||||||||||||||||| ||||||||||| |||  | ||||||  || |||||||||||| |||||||| |||  ||||| |||    
34653233 ttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgatgttaggatt-acctcacttataaacaaattgtcagatcaactcctaaccg 34653135  T
331 atgtgggactcttaacac 348  Q
    ||||| ||||||||||||    
34653134 atgtgagactcttaacac 34653117  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #55
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 229 - 313
Target Start/End: Original strand, 15042885 - 15042969
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtc 313  Q
    |||||||||| |||||| ||||||||||||||||| |||||||| ||  ||| | ||||||||||||||||||||||||||||||    
15042885 tcttagaaatcgtggttaggcctaacacaaccccacaaaaccggtttacgaggtaaggattgcccccacttataaacacattgtc 15042969  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #56
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 282 - 357
Target Start/End: Original strand, 39052589 - 39052665
Alignment:
282 tgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggactcttaacac-ccccctcac 357  Q
    ||||||||||||||||||||||||||||||||||| |||  |||||| ||||||||||||||||||| |||||||||    
39052589 tgaggattgcccccacttataaacacattgtcaggccatcacctatctgatgtgggactcttaacacaccccctcac 39052665  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #57
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 228 - 357
Target Start/End: Original strand, 3157007 - 3157137
Alignment:
228 ctcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattg-cccccacttataaacacattgtcaggtcatgtccta 326  Q
    ||||||||||||||| ||| |||||||||||||||| |||| |  ||| |||| ||||||||| ||||||||||||||||||||||  || |||   |||    
3157007 ctcttagaaatggtgattgagcctaacacaaccccacaaaa-catcttgtgaggtgaggattgccccccacttataaacacattgttgggccatcatcta 3157105  T
327 tccgatgtgggactcttaacac-ccccctcac 357  Q
    ||||||||| |||||||||||| |||||||||    
3157106 tccgatgtgagactcttaacacaccccctcac 3157137  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #58
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 229 - 352
Target Start/End: Complemental strand, 31197932 - 31197809
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    ||||| |||| ||| | ||||||||||||| ||||  |||| | ||| |||| ||||||||| | ||||||| ||||||||||||||| |||  ||||||    
31197932 tcttaaaaattgtgatcgggcctaacacaatcccaccaaactgacttgtgaggtgaggattgtctccacttacaaacacattgtcaggccatcacctatc 31197833  T
329 cgatgtgggactcttaacaccccc 352  Q
     |||||||||||||||||||||||    
31197832 tgatgtgggactcttaacaccccc 31197809  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #59
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 265 - 343
Target Start/End: Complemental strand, 7729990 - 7729912
Alignment:
265 aaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggactctt 343  Q
    ||||||||||| |||| |||||||||||||||||||||||||||| |||||| ||| || |||| ||||||||||||||    
7729990 aaaaccggcttgtgaggtgaggattgcccccacttataaacacatggtcaggccatctcatatctgatgtgggactctt 7729912  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #60
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 229 - 357
Target Start/End: Complemental strand, 20301592 - 20301452
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataa------aaccggcttctgagatgaggattgcccccacttataaacacattgtcagg-----t 317  Q
    |||||||||| ||||||||||||||||||||| || ||      ||||||||| || | ||||||||||||||||||||||||||||||||| |     |    
20301592 tcttagaaatcgtggttgggcctaacacaacctcaaaaccacacaaccggcttgtggggtgaggattgcccccacttataaacacattgtcatgccatct 20301493  T
318 catgtcctatccgatgtgggactcttaacac-ccccctcac 357  Q
    ||| || |||||||||||| ||||||||||| |||||||||    
20301492 catatcatatccgatgtggtactcttaacacaccccctcac 20301452  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #61
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 229 - 357
Target Start/End: Complemental strand, 21088224 - 21088084
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataa------aaccggcttctgagatgaggattgcccccacttataaacacattgtcagg-----t 317  Q
    |||||||||| ||||||||||||||||||||| || ||      ||||||||| || | ||||||||||||||||||||||||||||||||| |     |    
21088224 tcttagaaatcgtggttgggcctaacacaacctcaaaaccacacaaccggcttgtggggtgaggattgcccccacttataaacacattgtcatgccatct 21088125  T
318 catgtcctatccgatgtgggactcttaacac-ccccctcac 357  Q
    ||| || |||||||||||| ||||||||||| |||||||||    
21088124 catatcatatccgatgtggtactcttaacacaccccctcac 21088084  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #62
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 229 - 309
Target Start/End: Original strand, 42049686 - 42049766
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacat 309  Q
    |||||||||| |||||| |||||| ||||||| || ||||||||||| || | ||||||||||||||||||||||||||||    
42049686 tcttagaaatcgtggttaggcctaccacaacctcacaaaaccggcttgtggggtgaggattgcccccacttataaacacat 42049766  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #63
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 245 - 348
Target Start/End: Complemental strand, 16050329 - 16050227
Alignment:
245 tgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggactctta 344  Q
    |||| |||||||||||||| ||||||||||| |||| ||||||||| || |||||||||| | ||||||||| ||  ||||| |||||||| ||||||||    
16050329 tgggtctaacacaaccccacaaaaccggctt-tgaggtgaggattgtcctcacttataaataaattgtcaggccaactcctaaccgatgtgagactctta 16050231  T
345 acac 348  Q
    ||||    
16050230 acac 16050227  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #64
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 251 - 346
Target Start/End: Complemental strand, 39984877 - 39984782
Alignment:
251 taacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggactcttaac 346  Q
    ||||||||||||| ||||| ||||| |||| ||||||||||||||||||||||||| ||||||||  ||  |||||  ||||||| ||||||||||    
39984877 taacacaaccccacaaaactggcttgtgaggtgaggattgcccccacttataaacaaattgtcagaccaactcctaatcgatgtgagactcttaac 39984782  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #65
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 229 - 307
Target Start/End: Original strand, 8466723 - 8466801
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacac 307  Q
    |||||||||| ||||||||| |  |||||||||||||||||| |||| |||| ||||||||| ||||||||||||||||    
8466723 tcttagaaattgtggttgggtcgtacacaaccccataaaaccagcttgtgaggtgaggattgtccccacttataaacac 8466801  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #66
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 241 - 347
Target Start/End: Complemental strand, 31197688 - 31197582
Alignment:
241 tggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggact 340  Q
    ||||||||||||||||||||| | ||||||| ||| |||| |||| ||| |||  ||||||||||||||||||||  |||  |||||| ||||| |||||    
31197688 tggttgggcctaacacaaccctacaaaaccgacttttgaggtgagaattacccttacttataaacacattgtcagaccatcacctatctgatgtaggact 31197589  T
341 cttaaca 347  Q
    |||||||    
31197588 cttaaca 31197582  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #67
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 229 - 340
Target Start/End: Complemental strand, 20515229 - 20515121
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    ||||| |||| ||||||| | || ||| ||||||| ||||||||||| |||  ||||||||||||| ||||||||||||||||||||| ||| |||   |    
20515229 tcttataaattgtggttgaggctgacataaccccacaaaaccggcttgtgatgtgaggattgccccgacttataaacacattgtcaggccatctcc---c 20515133  T
329 cgatgtgggact 340  Q
    ||||||||||||    
20515132 cgatgtgggact 20515121  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #68
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 231 - 348
Target Start/End: Original strand, 28213105 - 28213221
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccg 330  Q
    |||||||| |||||||||||||||||||||||   |||  ||||| |||| ||||||||| || |||||||||||||||||||||  ||| || ||||      
28213105 ttagaaatcgtggttgggcctaacacaaccccgccaaattggcttgtgaggtgaggattg-ccgcacttataaacacattgtcagaccatctcatatctt 28213203  T
331 atgtgggactcttaacac 348  Q
    ||| ||||||||||||||    
28213204 atgcgggactcttaacac 28213221  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #69
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 231 - 347
Target Start/End: Complemental strand, 16050112 - 16049996
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccg 330  Q
    |||||| | ||||||||| |||||||||||||| ||||| | ||| |||| |||||||||||  |||||||||||| ||| ||||| ||  ||||| |||    
16050112 ttagaagtcgtggttgggtctaacacaaccccacaaaactgacttgtgaggtgaggattgccttcacttataaacaaattatcaggccaactcctaaccg 16050013  T
331 atgtgggactcttaaca 347  Q
    ||||| |||| ||||||    
16050012 atgtgagacttttaaca 16049996  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #70
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 228 - 343
Target Start/End: Original strand, 36907426 - 36907541
Alignment:
228 ctcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctat 327  Q
    ||||||||||  ||||||||||||||||||||||||  |||| ||||| | |  |||| ||||||||||||| | |||||||||||||  ||| || |||    
36907426 ctcttagaaagtgtggttgggcctaacacaaccccaccaaactggcttgtaatgtgagaattgcccccacttttgaacacattgtcagaccatctcttat 36907525  T
328 ccgatgtgggactctt 343  Q
    | || |||||||||||    
36907526 ctgacgtgggactctt 36907541  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #71
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 229 - 315
Target Start/End: Original strand, 422452 - 422538
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcag 315  Q
    |||||||||| ||||||||||| |||||||||||| |||| |||||| |||| ||| ||||||   |||||||||||| ||||||||    
422452 tcttagaaattgtggttgggccaaacacaaccccacaaaatcggcttatgagctgatgattgcatacacttataaacatattgtcag 422538  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #72
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 233 - 335
Target Start/End: Original strand, 4873694 - 4873795
Alignment:
233 agaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgat 332  Q
    |||||| |||||||||||||| |  ||  || ||||||||||| |||| |||| |||||| | ||||||||||||||||||||||||| || ||||||||    
4873694 agaaattgtggttgggcctaataagacaacacaaaaccggcttgtgaggtgagaattgccac-acttataaacacattgtcaggtcatctcttatccgat 4873792  T
333 gtg 335  Q
    |||    
4873793 gtg 4873795  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #73
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 229 - 347
Target Start/End: Original strand, 5676055 - 5676173
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| |||||||| |||||| ||  | ||||||| | | || |||||| ||||||||| ||| ||||||| |||||||||||||||  | |||     
5676055 tcttagaaatcgtggttggacctaacgcagtctcataaaatcagtttttgagataaggattgcctccatttataaatacattgtcaggtcatcacatatt 5676154  T
329 cgatgtgggactcttaaca 347  Q
     ||||||||||||||||||    
5676155 tgatgtgggactcttaaca 5676173  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #74
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 228 - 290
Target Start/End: Complemental strand, 10454512 - 10454450
Alignment:
228 ctcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattg 290  Q
    ||||||||||| ||||||| |||||||||||||| | |||||||||||||||| |||||||||    
10454512 ctcttagaaatcgtggttgagcctaacacaaccctacaaaaccggcttctgaggtgaggattg 10454450  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #75
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 229 - 343
Target Start/End: Original strand, 10614938 - 10615052
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    ||||| |||| ||||||| |||||| ||||||||| |||| |||||| |||| ||| |||| |||||| || |||||||||  ||| ||||| |  ||||    
10614938 tcttataaatcgtggttgagcctaatacaaccccacaaaatcggcttgtgaggtgaagattacccccatttgtaaacacatgttcatgtcatattttatc 10615037  T
329 cgatgtgggactctt 343  Q
    |||||||||||||||    
10615038 cgatgtgggactctt 10615052  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #76
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 284 - 357
Target Start/End: Original strand, 20094614 - 20094688
Alignment:
284 aggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggactcttaacac-ccccctcac 357  Q
    ||||||| |||||| |||||||||||||||||| ||| | |||| |||||||||||||||||||| |||||||||    
20094614 aggattgtccccacatataaacacattgtcaggccatcttctattcgatgtgggactcttaacacgccccctcac 20094688  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #77
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 230 - 312
Target Start/End: Original strand, 20094795 - 20094876
Alignment:
230 cttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgt 312  Q
    |||| |||| |||||||||||||| ||||||||| ||||||||||| | || |||||||||||||||| |||||||| |||||    
20094795 cttataaatcgtggttgggcctaa-acaaccccacaaaaccggcttgtaaggtgaggattgcccccacatataaacatattgt 20094876  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #78
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 265 - 343
Target Start/End: Original strand, 29907761 - 29907839
Alignment:
265 aaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggactctt 343  Q
    ||||||| ||| |||| ||||||||| ||||||||||||||||||||||||   || || |||||||||||||||||||    
29907761 aaaaccgacttgtgaggtgaggattgaccccacttataaacacattgtcagactatctcttatccgatgtgggactctt 29907839  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #79
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 229 - 343
Target Start/End: Original strand, 30201523 - 30201637
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||| ||||| ||||||||||| |||| | | ||| ||||||||||| |||| ||| ||||| ||||||||||||||  |||| || | ||| || ||||    
30201523 tcttcgaaatcgtggttgggccaaacatagctccacaaaaccggcttgtgaggtgaagattgaccccacttataaacttattgccatgccatctcttatc 30201622  T
329 cgatgtgggactctt 343  Q
    |||||||||||||||    
30201623 cgatgtgggactctt 30201637  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #80
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 229 - 307
Target Start/End: Complemental strand, 38476362 - 38476284
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacac 307  Q
    |||||||| | |||||| | ||||||||||||||| |||| |||||| |||| |||||||| |||||||||||||||||    
38476362 tcttagaatttgtggttagtcctaacacaaccccacaaaatcggcttgtgaggtgaggatttcccccacttataaacac 38476284  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #81
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 229 - 353
Target Start/End: Complemental strand, 6542000 - 6541875
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggatt-gcccccacttataaacacattgtcaggtcatgtcctat 327  Q
    |||||||| | | ||||||||||||||||| |||| ||||||||||| |||| ||||||||  ||||||||||||| ||| |  ||||| ||| ||   |    
6542000 tcttagaatttgcggttgggcctaacacaaacccacaaaaccggcttgtgaggtgaggattaccccccacttataagcacttgttcaggccatctcactt 6541901  T
328 ccgatgtgggactcttaacacccccc 353  Q
    || |||||||||||||||||| ||||    
6541900 ccaatgtgggactcttaacacgcccc 6541875  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #82
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 231 - 312
Target Start/End: Complemental strand, 8716197 - 8716116
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgt 312  Q
    ||||||||  |||||||| |||||||||||||| |||| |||||| |||| |||||||||||  ||||| ||||||||||||    
8716197 ttagaaatcttggttgggtctaacacaaccccacaaaatcggcttatgaggtgaggattgccttcacttttaaacacattgt 8716116  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #83
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 229 - 306
Target Start/End: Original strand, 26208248 - 26208325
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaaca 306  Q
    |||||||||| |||| ||| ||||||||||||||||||||| ||||| |||  ||  |||||||||||||||||||||    
26208248 tcttagaaattgtggatggacctaacacaaccccataaaactggcttatgatgtggagattgcccccacttataaaca 26208325  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #84
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 248 - 347
Target Start/End: Complemental strand, 7669485 - 7669386
Alignment:
248 gcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggactcttaaca 347  Q
    |||||||| ||||||| |||||| | || | |||||| |||||||||||||||||||||| ||||||   ||| | ||||||||||| || |||||||||    
7669485 gcctaacataaccccacaaaaccagtttgtaagatgatgattgcccccacttataaacacgttgtcaaaccatcttctatccgatgtagggctcttaaca 7669386  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #85
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 265 - 343
Target Start/End: Complemental strand, 6463241 - 6463163
Alignment:
265 aaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggactctt 343  Q
    ||||||||||  ||| |||| |||| |||||||||||||||| ||||||||||| | || ||||||||||| |||||||    
6463241 aaaaccggctcgtgacatgaagattacccccacttataaacaaattgtcaggtcttctcatatccgatgtgagactctt 6463163  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #86
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 229 - 315
Target Start/End: Complemental strand, 12688157 - 12688071
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcag 315  Q
    |||||||||| ||| ||| | |||||| ||| ||| ||||||||||| |||| || ||||||||| |||||||||||||||| ||||    
12688157 tcttagaaatcgtgtttgagtctaacataactccacaaaaccggcttgtgaggtggggattgccctcacttataaacacattatcag 12688071  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #87
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 265 - 347
Target Start/End: Original strand, 30966102 - 30966184
Alignment:
265 aaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggactcttaaca 347  Q
    ||||||||||| | || |||||| ||||||||||||||||||||||| || ||||| ||| |||  |||||||| ||||||||    
30966102 aaaaccggcttgtaaggtgaggactgcccccacttataaacacattgacatgtcatatcccatcgaatgtgggaatcttaaca 30966184  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #88
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 277 - 343
Target Start/End: Original strand, 34236695 - 34236761
Alignment:
277 tgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggactctt 343  Q
    |||| |||||||||| |||||||||||||||||||||||  ||| || |||||||||||| ||||||    
34236695 tgaggtgaggattgctcccacttataaacacattgtcagaccatctcttatccgatgtggcactctt 34236761  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #89
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 229 - 343
Target Start/End: Original strand, 37868582 - 37868696
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    ||||| |||| |||||| ||||||||||||  ||| |||||| |||| |||| ||||||||||||||| | ||||||||||  ||||| |||    | ||    
37868582 tcttaaaaatcgtggttaggcctaacacaattccacaaaaccagcttgtgaggtgaggattgcccccattaataaacacatgttcaggccatcatttgtc 37868681  T
329 cgatgtgggactctt 343  Q
    |||||||||||||||    
37868682 cgatgtgggactctt 37868696  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #90
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 231 - 280
Target Start/End: Complemental strand, 4963437 - 4963388
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgag 280  Q
    |||||||| |||||||||||||||||||||||| ||||||||||| ||||    
4963437 ttagaaattgtggttgggcctaacacaaccccacaaaaccggcttgtgag 4963388  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #91
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 228 - 317
Target Start/End: Complemental strand, 31827440 - 31827351
Alignment:
228 ctcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggt 317  Q
    |||||| ||||  ||||||||||||||| ||||||| ||||||  ||| ||||||||| |||| | || | |||||||||||||||||||    
31827440 ctcttaaaaatcatggttgggcctaacataaccccacaaaaccaacttatgagatgagaattgtcaccgcatataaacacattgtcaggt 31827351  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #92
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 229 - 309
Target Start/End: Complemental strand, 40014743 - 40014663
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacat 309  Q
    |||||||||| |||||| ||||| ||| || |||| ||||||| ||| |||  ||| ||||||||||||||||||||||||    
40014743 tcttagaaatcgtggtttggcctgacagaagcccacaaaaccgacttgtgaagtgaagattgcccccacttataaacacat 40014663  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #93
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 242 - 306
Target Start/End: Original strand, 45031373 - 45031437
Alignment:
242 ggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaaca 306  Q
    |||||||||||||||||||  | ||||||||||| | || ||||||||||||| |||||||||||    
45031373 ggttgggcctaacacaaccttacaaaaccggcttgtaaggtgaggattgccccgacttataaaca 45031437  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #94
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 252 - 343
Target Start/End: Complemental strand, 5940120 - 5940029
Alignment:
252 aacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggactctt 343  Q
    |||||||||| | |||||  |||| |||| ||||||||| ||||| |||||||||||||||||   ||| ||  ||||||||||||||||||    
5940120 aacacaaccctacaaaacttgcttgtgaggtgaggattgtccccatttataaacacattgtcaaaccatctctcatccgatgtgggactctt 5940029  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #95
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 260 - 315
Target Start/End: Complemental strand, 7669695 - 7669640
Alignment:
260 cccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcag 315  Q
    |||| ||||||  ||| |||| ||||||||||||||||||||||||||||||||||    
7669695 cccacaaaaccaacttgtgaggtgaggattgcccccacttataaacacattgtcag 7669640  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #96
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 240 - 353
Target Start/End: Complemental strand, 8715977 - 8715862
Alignment:
240 gtggttgggcctaacacaaccccataaaaccggcttctga-gatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtggga 338  Q
    ||||||||||||||| ||||| || ||||||| ||| ||| | |||| ||||||| |||||||| ||| ||||||| || || ||  |||||||||| ||    
8715977 gtggttgggcctaacccaacctcaaaaaaccgacttgtgatggtgagaattgccctcacttatagacatattgtcaagttatctctcatccgatgtgaga 8715878  T
339 ctctt-aacacccccc 353  Q
    ||||| ||||||||||    
8715877 ctcttaaacacccccc 8715862  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #97
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 230 - 309
Target Start/End: Original strand, 15686040 - 15686119
Alignment:
230 cttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacat 309  Q
    ||||||||| ||||||| | ||||||||| |||| ||||||||||| |||| |||| |||   |||||||||||||||||    
15686040 cttagaaatcgtggttgagtctaacacaatcccacaaaaccggcttgtgaggtgagaatttttcccacttataaacacat 15686119  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #98
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 229 - 312
Target Start/End: Original strand, 15797050 - 15797132
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgt 312  Q
    |||||||||| |||||||| |||| |||||||||| |||||| || | |||| |||||||||  | ||||||||||||||||||    
15797050 tcttagaaattgtggttgg-cctagcacaaccccacaaaacctgcgtgtgaggtgaggattgttctcacttataaacacattgt 15797132  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #99
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 235 - 346
Target Start/End: Original strand, 29099745 - 29099856
Alignment:
235 aaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgt 334  Q
    ||||||| ||| | |||||||| |||||| |||| | | || |||| ||| ||||||| ||||||||||||||||||||||  ||| | |||| |||| |    
29099745 aaatggtagttagacctaacactaccccacaaaatcagtttgtgaggtgaagattgcctccacttataaacacattgtcagaccatcttctattcgatat 29099844  T
335 gggactcttaac 346  Q
    | ||||||||||    
29099845 gagactcttaac 29099856  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #100
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 229 - 315
Target Start/End: Original strand, 36917255 - 36917342
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatg-aggattgcccccacttataaacacattgtcag 315  Q
    |||||||| ||||| ||  |||||||| |||  ||||||| ||| || ||||||| ||||||||| ||||||||||||||||||||||    
36917255 tcttagaagtggtgatttagcctaacaaaacttcataaaatcggtttgtgagatggaggattgcctccacttataaacacattgtcag 36917342  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #101
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 257 - 343
Target Start/End: Original strand, 3961426 - 3961512
Alignment:
257 aaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggactctt 343  Q
    ||||||| |||||| | || |||| |||  ||||| |||| |||||||||||||||||| |||| || |||| ||||||||||||||    
3961426 aaccccacaaaaccagtttgtgaggtgataattgctcccatttataaacacattgtcagctcatctcttatctgatgtgggactctt 3961512  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #102
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 229 - 335
Target Start/End: Complemental strand, 6463043 - 6462938
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    ||||| |||| |||||||||| |||||||||| || |||||| | || | |   |||| ||||| ||||||||||||||||||||| ||||| || ||||    
6463043 tcttaaaaattgtggttgggcataacacaaccgcacaaaacctgtttgttaagcgagg-ttgcctccacttataaacacattgtcaagtcatctcttatc 6462945  T
329 cgatgtg 335  Q
    |||||||    
6462944 cgatgtg 6462938  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #103
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 240 - 306
Target Start/End: Original strand, 6559459 - 6559525
Alignment:
240 gtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaaca 306  Q
    ||||||||| | |||| |||| || ||||||||||| | || |||||||||||||||||||||||||    
6559459 gtggttgggacgaacataacctcacaaaaccggcttgtaaggtgaggattgcccccacttataaaca 6559525  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #104
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 294 - 348
Target Start/End: Original strand, 19472314 - 19472368
Alignment:
294 ccacttataaacacattgtcaggtcatgtcctatccgatgtgggactcttaacac 348  Q
    ||||||||||||| ||||||||| ||  ||||| |||||||||||||||||||||    
19472314 ccacttataaacaaattgtcaggccaattcctaaccgatgtgggactcttaacac 19472368  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #105
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 294 - 348
Target Start/End: Original strand, 19543239 - 19543293
Alignment:
294 ccacttataaacacattgtcaggtcatgtcctatccgatgtgggactcttaacac 348  Q
    ||||||||||||| ||||||||| ||  ||||| |||||||||||||||||||||    
19543239 ccacttataaacaaattgtcaggccaattcctaaccgatgtgggactcttaacac 19543293  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #106
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 294 - 348
Target Start/End: Complemental strand, 19589457 - 19589403
Alignment:
294 ccacttataaacacattgtcaggtcatgtcctatccgatgtgggactcttaacac 348  Q
    ||||||||||||| ||||||||| ||  ||||| |||||||||||||||||||||    
19589457 ccacttataaacaaattgtcaggccaattcctaaccgatgtgggactcttaacac 19589403  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #107
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 84 - 158
Target Start/End: Original strand, 42720307 - 42720381
Alignment:
84 tgcagttatgtggtgataaagcttcagaagggatttttgttggtgctttcctttctatgtcttcaacagcagtgg 158  Q
    ||||||||||||||| |||| | || ||||| || ||||||||||| || || || |||||||||||||||||||    
42720307 tgcagttatgtggtggtaaatcatctgaaggaatatttgttggtgcatttctatccatgtcttcaacagcagtgg 42720381  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #108
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 265 - 343
Target Start/End: Original strand, 44931217 - 44931295
Alignment:
265 aaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggactctt 343  Q
    ||||||||||| ||||  ||||||||||||||||||||||||| |  ||||| ||| ||  | ||||||||||||||||    
44931217 aaaaccggcttgtgaggcgaggattgcccccacttataaacacttattcaggccatctctcaaccgatgtgggactctt 44931295  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #109
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 229 - 306
Target Start/End: Original strand, 16962245 - 16962322
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaaca 306  Q
    ||||| |||| |||||||| |||||||||| |||| |||||||| || |||| |||| ||||  ||||||||||||||    
16962245 tcttaaaaattgtggttggacctaacacaatcccacaaaaccggtttgtgaggtgagaattgttcccacttataaaca 16962322  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #110
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 231 - 280
Target Start/End: Original strand, 26208013 - 26208062
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgag 280  Q
    |||||||| |||||||||||||||| ||||||| ||||||||||| ||||    
26208013 ttagaaattgtggttgggcctaacataaccccacaaaaccggcttatgag 26208062  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #111
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 243 - 316
Target Start/End: Original strand, 27439560 - 27439633
Alignment:
243 gttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcagg 316  Q
    |||| |||| ||||||| ||| |||||| |||| ||||  |||||||| ||| |||||||||||||||||||||    
27439560 gttgagcctgacacaacgccacaaaaccagcttgtgaggcgaggattgaccctacttataaacacattgtcagg 27439633  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #112
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 265 - 357
Target Start/End: Original strand, 37868383 - 37868476
Alignment:
265 aaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggactc-ttaacacccccctcac 357  Q
    ||||||||||| |||| ||||||||||||||||| |||||||| |  ||||| |||    ||||||||||  ||||| ||||||||||||||||    
37868383 aaaaccggcttgtgaggtgaggattgcccccactaataaacacgtgttcaggccatcatttatccgatgttcgactctttaacacccccctcac 37868476  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #113
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 228 - 348
Target Start/End: Original strand, 5675732 - 5675852
Alignment:
228 ctcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctat 327  Q
    ||||||||||| ||  || | ||||||||||| ||| |||| | |||| |||| |||| |||| | | ||||||||||||||||||||  |||   ||||    
5675732 ctcttagaaatcgtaatttgacctaacacaactccacaaaatcagcttgtgaggtgagaattgtctctacttataaacacattgtcagaccatcatctat 5675831  T
328 ccgatgtgggactcttaacac 348  Q
    ||||||| |||||||| ||||    
5675832 ccgatgtaggactctttacac 5675852  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #114
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 306 - 357
Target Start/End: Original strand, 39052770 - 39052822
Alignment:
306 acattgtcaggtcatgtcctatccgatgtgggactcttaacac-ccccctcac 357  Q
    ||||||||||| |||  |||||||||||||||||||||||||| |||||||||    
39052770 acattgtcaggccatcacctatccgatgtgggactcttaacacaccccctcac 39052822  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #115
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 229 - 272
Target Start/End: Original strand, 24532285 - 24532328
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccgg 272  Q
    ||||||| || |||||||||||||||||||||||| ||||||||    
24532285 tcttagagatcgtggttgggcctaacacaaccccacaaaaccgg 24532328  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #116
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 282 - 317
Target Start/End: Complemental strand, 42584706 - 42584671
Alignment:
282 tgaggattgcccccacttataaacacattgtcaggt 317  Q
    |||| |||||||||||||||||||||||||||||||    
42584706 tgagtattgcccccacttataaacacattgtcaggt 42584671  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #117
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 240 - 306
Target Start/End: Original strand, 31079809 - 31079875
Alignment:
240 gtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaaca 306  Q
    ||||||| | |||||||| ||||| ||||| ||||| |||| |||||||||| | ||||||||||||    
31079809 gtggttgagtctaacacagccccacaaaactggcttttgaggtgaggattgctctcacttataaaca 31079875  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #118
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 229 - 275
Target Start/End: Complemental strand, 38476123 - 38476077
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggctt 275  Q
    |||||||||| |||||||||||||||| || |||| |||||||||||    
38476123 tcttagaaattgtggttgggcctaacataatcccacaaaaccggctt 38476077  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #119
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 229 - 275
Target Start/End: Original strand, 44694708 - 44694754
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggctt 275  Q
    |||||||| | |||||||||||||||||||||||| ||||| |||||    
44694708 tcttagaatttgtggttgggcctaacacaaccccacaaaactggctt 44694754  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #120
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 241 - 290
Target Start/End: Complemental strand, 45122418 - 45122369
Alignment:
241 tggttgggcctaacacaaccccataaaaccggcttctgagatgaggattg 290  Q
    |||||||||||||||||||||||  |||||||||| | || |||||||||    
45122418 tggttgggcctaacacaaccccacgaaaccggcttgtaaggtgaggattg 45122369  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #121
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 229 - 293
Target Start/End: Original strand, 10615155 - 10615219
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgccc 293  Q
    |||||||||| |||||||||| |||| |||||||| |||||  |||| | || ||||||||||||    
10615155 tcttagaaattgtggttgggcttaacgcaaccccacaaaactagcttgttaggtgaggattgccc 10615219  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #122
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 229 - 305
Target Start/End: Original strand, 26482675 - 26482749
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaac 305  Q
    |||||||||| ||| |||| |||||||||| || | |||| |||||| |||| ||||||||| ||||||||||||||    
26482675 tcttagaaatcgtgattgg-cctaacacaatcctaaaaaatcggcttgtgagttgaggattg-ccccacttataaac 26482749  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #123
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 241 - 309
Target Start/End: Original strand, 30953015 - 30953077
Alignment:
241 tggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacat 309  Q
    |||||||||||||||| |||||| |||| ||||||      ||||||||||||||||||||||||||||    
30953015 tggttgggcctaacac-accccacaaaatcggctt-----gtgaggattgcccccacttataaacacat 30953077  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #124
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 271 - 343
Target Start/End: Original strand, 31079603 - 31079675
Alignment:
271 ggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggactctt 343  Q
    ||||| |||| ||||||||||| ||||||||||||||||  ||| | ||| |  || ||||||||||||||||    
31079603 ggcttgtgaggtgaggattgcctccacttataaacacatgttcaagccatattttacccgatgtgggactctt 31079675  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 91; Significance: 5e-44; HSPs: 115)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 91; E-Value: 5e-44
Query Start/End: Original strand, 228 - 357
Target Start/End: Complemental strand, 21861615 - 21861485
Alignment:
228 ctcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctat 327  Q
    |||||||||||||||||||||||||||||||||||| |||| |||||| | || ||||||||||||||||||||||||||||||||||| |||||||| |    
21861615 ctcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtaaggtgaggattgcccccacttataaacacattgtcaggccatgtcctgt 21861516  T
328 ccgatgtgggactcttaacac-ccccctcac 357  Q
    ||||||||| ||||||||||| |||||||||    
21861515 ccgatgtggaactcttaacacaccccctcac 21861485  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 89; E-Value: 8e-43
Query Start/End: Original strand, 231 - 347
Target Start/End: Complemental strand, 29469688 - 29469572
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccg 330  Q
    |||||||| |||||||||||||||||||||||| ||||||||||| | || ||||||||||||||||||||||||||||||||||| |||||||| ||||    
29469688 ttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtaaggtgaggattgcccccacttataaacacattgtcaggccatgtcctgtccg 29469589  T
331 atgtgggactcttaaca 347  Q
    |||||||||||||||||    
29469588 atgtgggactcttaaca 29469572  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 231 - 357
Target Start/End: Complemental strand, 29469923 - 29469796
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccg 330  Q
    |||||||| |||||||||||||||||||| ||| ||||||||||| | || ||||||||||||||||||||||||||||||||||| |||||||| ||||    
29469923 ttagaaatcgtggttgggcctaacacaactccacaaaaccggcttgtaaggtgaggattgcccccacttataaacacattgtcaggccatgtcctgtccg 29469824  T
331 atgtgggactcttaacac-ccccctcac 357  Q
    |||||||||||||||||| |||||||||    
29469823 atgtgggactcttaacacaccccctcac 29469796  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 229 - 347
Target Start/End: Original strand, 21054952 - 21055070
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    ||||||||||||||||||||||||||||||||||| ||||||||||| |||| ||||||||||||||||||||||||| ||||||||| |||  ||||||    
21054952 tcttagaaatggtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacatattgtcaggccatcacctatc 21055051  T
329 cgatgtgggactcttaaca 347  Q
    |||| ||||||||||||||    
21055052 cgatatgggactcttaaca 21055070  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 229 - 347
Target Start/End: Complemental strand, 21861379 - 21861261
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||||||||||||||||||||||| |||| ||||||||||| | || |||||||||||| |||||||||||||||||||||| |||||||| ||    
21861379 tcttagaaatggtggttgggcctaacacaatcccacaaaaccggcttgtaaggtgaggattgccctcacttataaacacattgtcaggccatgtcctgtc 21861280  T
329 cgatgtgggactcttaaca 347  Q
    |||||||||||||||||||    
21861279 cgatgtgggactcttaaca 21861261  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 84; E-Value: 8e-40
Query Start/End: Original strand, 229 - 348
Target Start/End: Original strand, 43688159 - 43688277
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| |||||||||||||||||||||||| ||| |||||||  ||| | ||||||||||||||||||||||||||||||||| |||||||||||    
43688159 tcttagaaatcgtggttgggcctaacacaaccccacaaa-ccggcttgagaggtaaggattgcccccacttataaacacattgtcaggccatgtcctatc 43688257  T
329 cgatgtgggactcttaacac 348  Q
    ||||||||||||||||||||    
43688258 cgatgtgggactcttaacac 43688277  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 229 - 347
Target Start/End: Complemental strand, 47710528 - 47710410
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    ||||||||||||||||||||||||||||||||||| ||||| ||||| |||| ||||||||||||||||||||||||||||||| ||| |||  ||||||    
47710528 tcttagaaatggtggttgggcctaacacaaccccacaaaactggcttgtgaggtgaggattgcccccacttataaacacattgtaaggccatcacctatc 47710429  T
329 cgatgtgggactcttaaca 347  Q
    ||||||| |||||||||||    
47710428 cgatgtgagactcttaaca 47710410  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 229 - 347
Target Start/End: Complemental strand, 47722184 - 47722066
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    ||||||||||||||||||||||||||||||||||| ||||| ||||| |||| ||||||||||||||||||||||||||||||| ||| |||  ||||||    
47722184 tcttagaaatggtggttgggcctaacacaaccccacaaaactggcttgtgaggtgaggattgcccccacttataaacacattgtaaggccatcacctatc 47722085  T
329 cgatgtgggactcttaaca 347  Q
    ||||||| |||||||||||    
47722084 cgatgtgagactcttaaca 47722066  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 229 - 348
Target Start/End: Original strand, 26239915 - 26240034
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| ||||||||| |||||||||||||| || |||| ||| |||| ||||||||||||||||||||||||||||||||||  |||||||||||    
26239915 tcttagaaattgtggttgggtctaacacaaccccacaataccgacttgtgaggtgaggattgcccccacttataaacacattgtcagaccatgtcctatc 26240014  T
329 cgatgtgggactcttaacac 348  Q
    |||||| |||||||||||||    
26240015 cgatgtcggactcttaacac 26240034  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 231 - 357
Target Start/End: Complemental strand, 34027476 - 34027349
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccg 330  Q
    |||||||| |||||||||||||||||||||||| ||||||||||| |||| ||||||||||||||||||||||||| ||||||||| ||  ||||| |||    
34027476 ttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcaggccaactcctaaccg 34027377  T
331 atgtgggactcttaacac-ccccctcac 357  Q
    |||||||| ||||||||| |||||||||    
34027376 atgtgggattcttaacacaccccctcac 34027349  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 229 - 346
Target Start/End: Complemental strand, 25620221 - 25620105
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| |||||||||||||||||||||||| ||||||||||| |||| |||||||||||||||||||||||||||||||||||||||| |||       
25620221 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacacattgtcaggtcatggcct-ga 25620123  T
329 cgatgtgggactcttaac 346  Q
    | ||||||||||||||||    
25620122 caatgtgggactcttaac 25620105  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 76; E-Value: 5e-35
Query Start/End: Original strand, 229 - 348
Target Start/End: Complemental strand, 1596913 - 1596794
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||| ||| |||||||||||||||||||||| | ||||||||||| | || ||||||||||||||||||||||| ||||||| ||| |||||||| ||    
1596913 tcttagtaattgtggttgggcctaacacaaccctacaaaaccggcttgtaaggtgaggattgcccccacttataaaaacattgttaggccatgtcctgtc 1596814  T
329 cgatgtgggactcttaacac 348  Q
    ||||||||||||||||||||    
1596813 cgatgtgggactcttaacac 1596794  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 76; E-Value: 5e-35
Query Start/End: Original strand, 229 - 348
Target Start/End: Original strand, 36277225 - 36277344
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| ||||||||| |||||||||||||| |||| || ||| |||| ||||||||||||||||||||||||||||||||||| |||||| | ||    
36277225 tcttagaaatcgtggttgggactaacacaaccccacaaaatcgacttgtgaggtgaggattgcccccacttataaacacattgtcaggccatgtcttgtc 36277324  T
329 cgatgtgggactcttaacac 348  Q
    ||||||| ||||||||||||    
36277325 cgatgtgagactcttaacac 36277344  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 229 - 347
Target Start/End: Complemental strand, 1596678 - 1596561
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| |||||| ||||||||||||||||| ||| ||||||| | || |||||||||||||||||||| |||||||||||||| |||||||| ||    
1596678 tcttagaaattgtggttaggcctaacacaaccccacaaa-ccggcttgtaaggtgaggattgcccccacttattaacacattgtcaggccatgtcctgtc 1596580  T
329 cgatgtgggactcttaaca 347  Q
    |||||||||||||||||||    
1596579 cgatgtgggactcttaaca 1596561  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 229 - 357
Target Start/End: Original strand, 48243060 - 48243187
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    ||||| |||| |||||||||||||||||||||||| ||||||||||| |||| ||||||||||||||||||||||||||||||||||  ||  || ||||    
48243060 tcttacaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacacattgtcagacca--tcatatc 48243157  T
329 cgatgtgggactcttaacac-ccccctcac 357  Q
     ||||||||||||||||||| |||||||||    
48243158 tgatgtgggactcttaacacaccccctcac 48243187  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #16
Raw Score: 74; E-Value: 7e-34
Query Start/End: Original strand, 229 - 357
Target Start/End: Complemental strand, 31892472 - 31892343
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| |||||||||||||||||| ||||| ||||||||||| |||| ||| ||||| ||||||||||||| ||||||||| ||||||| | |||    
31892472 tcttagaaatcgtggttgggcctaacacatccccacaaaaccggcttgtgaggtgaagattgtccccacttataaatacattgtcatgtcatgttccatc 31892373  T
329 cgatgtgggactcttaacac-ccccctcac 357  Q
    ||||||| |||||||||||| |||||||||    
31892372 cgatgtgagactcttaacacaccccctcac 31892343  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #17
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 232 - 348
Target Start/End: Complemental strand, 3393064 - 3392948
Alignment:
232 tagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccga 331  Q
    |||||||||||||||||||||||||||||||| |||| |||||| |||| |||| |||  ||||||||||||||||||||||||| |||  |||||||||    
3393064 tagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagaattttccccacttataaacacattgtcaggccatcacctatccga 3392965  T
332 tgtgggactcttaacac 348  Q
    |||| ||||||||||||    
3392964 tgtgagactcttaacac 3392948  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #18
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 235 - 347
Target Start/End: Complemental strand, 17202258 - 17202146
Alignment:
235 aaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgt 334  Q
    |||| |||||||||||||||||||||||| ||||||||||| ||||||||| |||||||||||||||||||| ||||||||| ||  || || |||||||    
17202258 aaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgagatgagaattgcccccacttataaacaaattgtcaggccaactcttaaccgatgt 17202159  T
335 gggactcttaaca 347  Q
    |||||||||||||    
17202158 gggactcttaaca 17202146  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #19
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 229 - 345
Target Start/End: Original strand, 33996310 - 33996426
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| |||||||||||||||||||| ||| ||||||| ||| |||| ||| ||||||||||||||||||| ||||| | ||| |||||||||||    
33996310 tcttagaaatcgtggttgggcctaacacaactccacaaaaccgacttgtgaggtgaagattgcccccacttataaatacattattaggccatgtcctatc 33996409  T
329 cgatgtgggactcttaa 345  Q
    |||||||||||||||||    
33996410 cgatgtgggactcttaa 33996426  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #20
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 232 - 352
Target Start/End: Original strand, 44874348 - 44874468
Alignment:
232 tagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccga 331  Q
    ||||||| |||||||||||||||||||||  | |||| ||| || |||| |||||||| ||||||||||||||||||||||||||| || ||||||||||    
44874348 tagaaatcgtggttgggcctaacacaaccatacaaaatcggtttgtgaggtgaggatttcccccacttataaacacattgtcaggttatctcctatccga 44874447  T
332 tgtgggactcttaacaccccc 352  Q
    ||||||||||||||| |||||    
44874448 tgtgggactcttaaccccccc 44874468  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #21
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 231 - 347
Target Start/End: Original strand, 48661556 - 48661672
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccg 330  Q
    |||||||| ||||||||| ||||||||| | || ||||||||||| |||| |||||||||||||||| |||||| ||||||||||||||| ||||||| |    
48661556 ttagaaatcgtggttgggtctaacacaatctcacaaaaccggcttgtgaggtgaggattgcccccacctataaatacattgtcaggtcatctcctatctg 48661655  T
331 atgtgggactcttaaca 347  Q
    |||||||||||||||||    
48661656 atgtgggactcttaaca 48661672  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #22
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 228 - 357
Target Start/End: Original strand, 2404172 - 2404301
Alignment:
228 ctcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctat 327  Q
    ||||||||||| ||||||||||||||||||||||   ||||||| ||| || | | ||||||||||||||||||||||||||||||||  ||| |||||     
2404172 ctcttagaaattgtggttgggcctaacacaacccttaaaaaccgacttgtggggttaggattgcccccacttataaacacattgtcagtccatctcctaa 2404271  T
328 ccgatgtgggactcttaacacccccctcac 357  Q
    ||||||||||||||||||||| || |||||    
2404272 ccgatgtgggactcttaacacacctctcac 2404301  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #23
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 228 - 349
Target Start/End: Complemental strand, 6634941 - 6634820
Alignment:
228 ctcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctat 327  Q
    |||||||||||  ||||||||||||||||||||||| |||||  |||| |||| ||||||||||||||||||||||||| ||||||||| ||  |||||     
6634941 ctcttagaaatcatggttgggcctaacacaaccccacaaaactagcttatgaggtgaggattgcccccacttataaacaaattgtcaggccaactcctaa 6634842  T
328 ccgatgtgggactcttaacacc 349  Q
    |||||||| |||||||||||||    
6634841 ccgatgtgagactcttaacacc 6634820  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #24
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 231 - 348
Target Start/End: Original strand, 26562074 - 26562191
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccg 330  Q
    |||||||||||||||| |||||||| ||||||| ||||||||||| |||| ||| ||||||||||||||||||||| ||||||||| ||  ||||| |||    
26562074 ttagaaatggtggttgagcctaacataaccccacaaaaccggcttgtgaggtgaagattgcccccacttataaacaaattgtcaggccaactcctaaccg 26562173  T
331 atgtgggactcttaacac 348  Q
    ||||| ||||||||||||    
26562174 atgtgagactcttaacac 26562191  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #25
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 229 - 357
Target Start/End: Complemental strand, 34027712 - 34027583
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| ||| |||||||||||||||||||| ||||||||||| |||  ||||||||||||||||||||||||| ||||||||| ||  | ||| |    
34027712 tcttagaaatcgtgattgggcctaacacaaccccacaaaaccggcttgtgaagtgaggattgcccccacttataaacaaattgtcaggccaacttctaac 34027613  T
329 cgatgtgggactcttaacac-ccccctcac 357  Q
     ||||||||||||||||||| |||||||||    
34027612 tgatgtgggactcttaacacaccccctcac 34027583  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #26
Raw Score: 69; E-Value: 7e-31
Query Start/End: Original strand, 235 - 347
Target Start/End: Original strand, 2544452 - 2544564
Alignment:
235 aaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgt 334  Q
    |||| |||||||||||||||||||||||| ||||||| ||| |||| ||||||||||||||||||||||||| ||||||||| ||  ||||| |||| ||    
2544452 aaatcgtggttgggcctaacacaaccccacaaaaccgacttgtgaggtgaggattgcccccacttataaacaaattgtcaggccaactcctaaccgacgt 2544551  T
335 gggactcttaaca 347  Q
    |||||||||||||    
2544552 gggactcttaaca 2544564  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #27
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 229 - 348
Target Start/End: Original strand, 18826487 - 18826606
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    ||||||||||  ||||||  ||||||||||||||| |||| | |||| |||| |||| ||| |||||||||||||||||||||||||||||| |||||||    
18826487 tcttagaaattatggttgaacctaacacaaccccacaaaatcagcttgtgagttgagaattacccccacttataaacacattgtcaggtcatctcctatc 18826586  T
329 cgatgtgggactcttaacac 348  Q
    | ||||||||||||||||||    
18826587 caatgtgggactcttaacac 18826606  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #28
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 229 - 347
Target Start/End: Original strand, 3038083 - 3038201
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    ||||||||||  ||||||||||||||||||||||| ||||||||||| |||  ||||||||||||||||||||||||||||||| ||   || || |||     
3038083 tcttagaaatcatggttgggcctaacacaaccccacaaaaccggcttgtgacgtgaggattgcccccacttataaacacattgttagacaatctcttatt 3038182  T
329 cgatgtgggactcttaaca 347  Q
    |||||||||||||||||||    
3038183 cgatgtgggactcttaaca 3038201  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #29
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 230 - 348
Target Start/End: Original strand, 6001435 - 6001553
Alignment:
230 cttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatcc 329  Q
    |||| |||| |||||||||  ||||| ||||| | |||| ||| ||||||| ||||||||||||||||||||||||| ||||||||||||| | ||||||    
6001435 cttaaaaatcgtggttgggtttaacataaccctacaaaatcggtttctgaggtgaggattgcccccacttataaacatattgtcaggtcatcttctatcc 6001534  T
330 gatgtgggactcttaacac 348  Q
    |||||||||||||||||||    
6001535 gatgtgggactcttaacac 6001553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #30
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 241 - 347
Target Start/End: Original strand, 48243448 - 48243554
Alignment:
241 tggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggact 340  Q
    |||||||| |||||||||||||| ||||||||||| | |||||||||||||||||||||||||||||||||||||| |||  | ||| | ||||||||||    
48243448 tggttgggtctaacacaaccccacaaaaccggcttgtaagatgaggattgcccccacttataaacacattgtcaggccatcacatattcaatgtgggact 48243547  T
341 cttaaca 347  Q
    |||||||    
48243548 cttaaca 48243554  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #31
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 229 - 353
Target Start/End: Complemental strand, 4268140 - 4268015
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaa-ccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctat 327  Q
    ||||||||||  ||||||||||||||||||||||| |||| ||||||| |||| ||| ||||||||||||||||||||| ||||||||| ||  |||||     
4268140 tcttagaaatcttggttgggcctaacacaaccccaaaaaaaccggcttttgaggtgatgattgcccccacttataaacaaattgtcaggccaactcctaa 4268041  T
328 ccgatgtgggactcttaacacccccc 353  Q
    | ||||||||||||||||||| ||||    
4268040 ctgatgtgggactcttaacacacccc 4268015  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #32
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 228 - 357
Target Start/End: Original strand, 40746031 - 40746160
Alignment:
228 ctcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctat 327  Q
    ||||||||||| ||||||||| ||||||||| |||| |||| ||| || |||| ||| ||||| |||  |||||||||||||||||  | ||||||||||    
40746031 ctcttagaaattgtggttgggtctaacacaatcccacaaaatcggtttgtgaggtgaagattgtcccttcttataaacacattgtctagccatgtcctat 40746130  T
328 ccgatgtgggactcttaacacccccctcac 357  Q
    ||||||||||||||||||||| ||||||||    
40746131 ccgatgtgggactcttaacacacccctcac 40746160  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #33
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 229 - 357
Target Start/End: Original strand, 36993073 - 36993201
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    ||||||||||  ||||||||||||||||||||||| |||||| |||| |||| |||| ||||| || ||||||||||||||||||||  |||||| ||||    
36993073 tcttagaaatcatggttgggcctaacacaaccccacaaaaccagcttgtgaggtgagcattgctcctacttataaacacattgtcagaccatgtcatatc 36993172  T
329 cgatgtgggactcttaacacccccctcac 357  Q
    |||||| | ||||||||||| | ||||||    
36993173 cgatgttgaactcttaacacacacctcac 36993201  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #34
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 227 - 357
Target Start/End: Original strand, 3519727 - 3519853
Alignment:
227 tctcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtccta 326  Q
    ||||| |||||| ||||||| |||||||||| ||||| |||||||||||      |||||||| |||||||||||||||||||||||||| |||  ||||    
3519727 tctctaagaaatcgtggttgagcctaacacagccccacaaaaccggctt-----gtgaggattacccccacttataaacacattgtcaggccatcaccta 3519821  T
327 tccgatgtgggactcttaacac-ccccctcac 357  Q
    |||||||||||||||||||||| |||||||||    
3519822 tccgatgtgggactcttaacacaccccctcac 3519853  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #35
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 235 - 353
Target Start/End: Original strand, 2544220 - 2544338
Alignment:
235 aaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgt 334  Q
    |||| ||||| |||||||||||||||||| ||||| ||||| | || ||| ||||||||||||||||||||| ||||||||  ||  ||||| |||||||    
2544220 aaatcgtggtagggcctaacacaaccccacaaaactggcttgtaaggtgaagattgcccccacttataaacaaattgtcagaccaactcctaaccgatgt 2544319  T
335 gggactcttaacacccccc 353  Q
    |||||||||||||||||||    
2544320 gggactcttaacacccccc 2544338  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #36
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 231 - 357
Target Start/End: Complemental strand, 40746581 - 40746455
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccg 330  Q
    ||||||||  |||||||||||||||||||| || ||||| ||||| |||| || ||||| |||||||||||||||| ||||||||| ||  ||||| ||     
40746581 ttagaaatcatggttgggcctaacacaacctcacaaaactggcttgtgaggtgtggatttcccccacttataaacaaattgtcaggccaactcctaacca 40746482  T
331 atgtgggactcttaacacccccctcac 357  Q
    |||||||||||||||||| ||||||||    
40746481 atgtgggactcttaacacacccctcac 40746455  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #37
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 251 - 347
Target Start/End: Complemental strand, 46452696 - 46452599
Alignment:
251 taacacaaccccataaaaccggcttctgagatgaggattgccccc-acttataaacacattgtcaggtcatgtcctatccgatgtgggactcttaaca 347  Q
    ||||||||||||| ||||||  ||| |||| |||||||||||||| |||||||||||||||||  |||||||||||||||||||||||||||||||||    
46452696 taacacaaccccacaaaaccaacttgtgaggtgaggattgccccccacttataaacacattgtgtggtcatgtcctatccgatgtgggactcttaaca 46452599  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #38
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 231 - 347
Target Start/End: Original strand, 36206064 - 36206180
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccg 330  Q
    |||||||| ||||||| |||||| ||||||||||||||||||||| |||| ||| ||||||| ||||||||||||| ||||| ||| ||  ||||| |||    
36206064 ttagaaatcgtggttgagcctaatacaaccccataaaaccggcttgtgaggtgaagattgcctccacttataaacaaattgttaggccaactcctaaccg 36206163  T
331 atgtgggactcttaaca 347  Q
    |||||| ||||||||||    
36206164 atgtggaactcttaaca 36206180  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #39
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 231 - 338
Target Start/End: Complemental strand, 40746348 - 40746241
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccg 330  Q
    |||||||| |||||||||||||||||||||||| |||| |||||| |||| |||||||||||| |||||||||||| ||||||||| ||  ||||| ||     
40746348 ttagaaattgtggttgggcctaacacaaccccacaaaatcggcttatgaggtgaggattgccctcacttataaacaaattgtcaggccaactcctaacca 40746249  T
331 atgtggga 338  Q
    ||||||||    
40746248 atgtggga 40746241  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #40
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 229 - 347
Target Start/End: Original strand, 2404407 - 2404525
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| ||||||| || ||||||| ||| ||||||||| ||| || | ||||||||||||| ||||||||||||||||||||  | | |||||||    
2404407 tcttagaaatcgtggttgagcttaacacagccctataaaaccgacttgtggggtgaggattgcccctacttataaacacattgtcagtccgtctcctatc 2404506  T
329 cgatgtgggactcttaaca 347  Q
    ||| |||||||||||||||    
2404507 cgacgtgggactcttaaca 2404525  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #41
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 231 - 347
Target Start/End: Complemental strand, 10903168 - 10903051
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccg 330  Q
    |||| ||| ||||||||| |||||||||| ||| ||||||||||| |||| |||||||| |||| ||||||||||| ||||||| | |||||||||| ||    
10903168 ttagtaatcgtggttggggctaacacaactccacaaaaccggcttgtgaggtgaggattacccctacttataaacatattgtcaagccatgtcctattcg 10903069  T
331 atgtg-ggactcttaaca 347  Q
    ||||| ||||||||||||    
10903068 atgtgtggactcttaaca 10903051  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #42
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 227 - 348
Target Start/End: Complemental strand, 22574922 - 22574802
Alignment:
227 tctcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtccta 326  Q
    |||||||||||| ||||||||||||||||||| | || |||  |||||| |||| |||||||||||| |||||||||| ||||||||| |||||  | ||    
22574922 tctcttagaaatcgtggttgggcctaacacaaactcacaaatacggcttgtgaggtgaggattgccctcacttataaa-acattgtcatgtcatcacata 22574824  T
327 tccgatgtgggactcttaacac 348  Q
    ||||||||| ||||||||||||    
22574823 tccgatgtgagactcttaacac 22574802  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #43
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 234 - 339
Target Start/End: Original strand, 32278889 - 32278994
Alignment:
234 gaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatg 333  Q
    ||||||||||||| ||||||||||||| || ||||||||||| |||| ||| ||||| ||||||||||||||||||||||||  |||  | |||||||||    
32278889 gaaatggtggttgagcctaacacaacctcacaaaaccggcttatgaggtgacgattgtccccacttataaacacattgtcagaccatcacatatccgatg 32278988  T
334 tgggac 339  Q
    ||||||    
32278989 tgggac 32278994  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #44
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 229 - 341
Target Start/End: Original strand, 32879613 - 32879726
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattg-cccccacttataaacacattgtcaggtcatgtcctat 327  Q
    |||||||| | || ||||||||||||||||||||  ||||||||||| |||| ||||||||| |||||||||||||||||||||||||| ||| || ||     
32879613 tcttagaagtcgtcgttgggcctaacacaaccccgcaaaaccggcttgtgaggtgaggattgccccccacttataaacacattgtcaggccatctcttaa 32879712  T
328 ccgatgtgggactc 341  Q
    |||| |||||||||    
32879713 ccgaagtgggactc 32879726  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #45
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 229 - 357
Target Start/End: Original strand, 36276990 - 36277119
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| |||||| |||||||||||| ||||||||||| |||| |||| |||| |||| ||||||||||||||||||||||||   ||| | | ||    
36276990 tcttagaaatcgtggttaggcctaacacaatcccataaaacctgcttgtgaggtgagaattgtccccacttataaacacattgtcagactatgccatgtc 36277089  T
329 cgatgtgggactcttaacac-ccccctcac 357  Q
     |||||| |||||||||||| |||||||||    
36277090 tgatgtgagactcttaacacaccccctcac 36277119  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #46
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 235 - 343
Target Start/End: Original strand, 11211684 - 11211791
Alignment:
235 aaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgt 334  Q
    |||| ||||||||||| |||||||||||| ||||||||||| |||| ||||||||| ||||||||||||| ||||||| ||| ||| || ||||||| ||    
11211684 aaatcgtggttgggcccaacacaaccccacaaaaccggcttgtgaggtgaggattg-ccccacttataaagacattgttaggccatctcttatccgacgt 11211782  T
335 gggactctt 343  Q
    |||||||||    
11211783 gggactctt 11211791  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #47
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 229 - 345
Target Start/End: Complemental strand, 21821891 - 21821775
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| ||||||||||||||||||| |||| |||| ||| || |||||||| |||||||||||||||| |||| ||||||||| ||| || ||||    
21821891 tcttagaaatcgtggttgggcctaacacaatcccacaaaatcggtttgtgagatgaagattgcccccacttattaacatattgtcaggccatctcatatc 21821792  T
329 cgatgtgggactcttaa 345  Q
     |||||| || ||||||    
21821791 tgatgtgagagtcttaa 21821775  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #48
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 231 - 347
Target Start/End: Original strand, 31257268 - 31257384
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccg 330  Q
    |||||||| |||||||||||||||||||||||| ||||||||||| |||  | ||||||||||||||||||||| | ||||||||  ||  ||||| |||    
31257268 ttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaattaaggattgcccccacttataaataaattgtcagaccaactcctaaccg 31257367  T
331 atgtgggactcttaaca 347  Q
    ||||| ||| |||||||    
31257368 atgtgagacgcttaaca 31257384  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #49
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 245 - 348
Target Start/End: Complemental strand, 25620440 - 25620337
Alignment:
245 tgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggactctta 344  Q
    ||||| |||||||| || | |||||| |||| |||| || |||||||||| |||||||| |||||||||||||||||||||||| ||||| |||||||||    
25620440 tgggcttaacacaatcctacaaaacctgcttgtgaggtggggattgcccctacttataagcacattgtcaggtcatgtcctatctgatgtaggactctta 25620341  T
345 acac 348  Q
    ||||    
25620340 acac 25620337  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #50
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 244 - 347
Target Start/End: Complemental strand, 31892221 - 31892118
Alignment:
244 ttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggactctt 343  Q
    |||||||||||| ||| ||| ||||||||||| |||| ||||||||| ||||||||||||| ||||||||| |  || ||||||||||||||||||| ||    
31892221 ttgggcctaacataactccacaaaaccggcttgtgaggtgaggattgtccccacttataaatacattgtcatgctatatcctatccgatgtgggactttt 31892122  T
344 aaca 347  Q
    ||||    
31892121 aaca 31892118  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #51
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 229 - 346
Target Start/End: Original strand, 33996078 - 33996195
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    ||||| |||| |||||||  ||||| ||||| ||||||||  ||||| |||| ||||||||| |||||| |||||||||||||||||   ||||| ||||    
33996078 tcttaaaaatcgtggttgaacctaatacaactccataaaatgggcttgtgaggtgaggattgtccccacgtataaacacattgtcagacaatgtcttatc 33996177  T
329 cgatgtgggactcttaac 346  Q
    ||||||||||||||||||    
33996178 cgatgtgggactcttaac 33996195  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #52
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 229 - 333
Target Start/End: Complemental strand, 4886414 - 4886310
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| ||||||||||||||||||||| |   |||||||||| |||| ||||||||||||||| | ||||||| ||||||||| |||||| | ||    
4886414 tcttagaaatcgtggttgggcctaacacaacctcgccaaaccggcttgtgaggtgaggattgcccccattaataaacatattgtcaggccatgtcatgtc 4886315  T
329 cgatg 333  Q
    |||||    
4886314 cgatg 4886310  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #53
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 235 - 347
Target Start/End: Original strand, 14540957 - 14541068
Alignment:
235 aaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgt 334  Q
    ||||| ||||||||||||||||||||||| ||||||| ||| |||| || ||||||||||||||||| |||  ||||||| ||||| || ||| ||||||    
14540957 aaatgatggttgggcctaacacaaccccacaaaaccgacttatgaggtgtggattgcccccacttat-aacgtattgtcaagtcatttcatattcgatgt 14541055  T
335 gggactcttaaca 347  Q
    | |||||||||||    
14541056 gagactcttaaca 14541068  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #54
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 233 - 335
Target Start/End: Original strand, 3520042 - 3520145
Alignment:
233 agaaatggtggttgggcctaacacaacccc-ataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccga 331  Q
    |||||| |||||||  |||||||||||||  |||||||||||||  ||| ||||||||||||||||||||||||||||||||||  |||  |||||||||    
3520042 agaaatcgtggttgaacctaacacaacccttataaaaccggcttgcgaggtgaggattgcccccacttataaacacattgtcagaccatcacctatccga 3520141  T
332 tgtg 335  Q
    ||||    
3520142 tgtg 3520145  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #55
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 231 - 314
Target Start/End: Original strand, 10882007 - 10882089
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtca 314  Q
    |||||||| |||||||||||||| | ||||||| ||||||||||| |||| ||||||||||||||||||||||||| |||||||    
10882007 ttagaaatcgtggttgggcctaata-aaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtca 10882089  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #56
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 247 - 357
Target Start/End: Original strand, 31485441 - 31485552
Alignment:
247 ggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggactcttaac 346  Q
    |||||||||||||| || |||||| | || |||  ||||||||||||||||||||||||||||||||||| |||  | ||||  ||||||||||||||||    
31485441 ggcctaacacaacctcacaaaaccagtttgtgatgtgaggattgcccccacttataaacacattgtcaggccatcacatatcttatgtgggactcttaac 31485540  T
347 ac-ccccctcac 357  Q
    || |||||||||    
31485541 acaccccctcac 31485552  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #57
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 229 - 316
Target Start/End: Original strand, 31485658 - 31485745
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcagg 316  Q
    |||||||||| |||||| |||||||||||||  || ||||||||||| | || ||||||||||||||||||||||| |||||||||||    
31485658 tcttagaaattgtggttaggcctaacacaacttcacaaaaccggcttgtcaggtgaggattgcccccacttataaaaacattgtcagg 31485745  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #58
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 229 - 320
Target Start/End: Original strand, 43085536 - 43085627
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcat 320  Q
    |||||||||| ||||||| || ||||||||||||| ||||||  ||| |||| |||||||||||||||||||||||||| |||||| |||||    
43085536 tcttagaaatcgtggttgagcttaacacaaccccacaaaaccaacttgtgaggtgaggattgcccccacttataaacacgttgtcatgtcat 43085627  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #59
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 229 - 348
Target Start/End: Complemental strand, 4267941 - 4267820
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaa--ccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtccta 326  Q
    ||||| |||| ||||||||||||||||||| || | ||||  |  |||| |||| ||||||||||||||||||||||||| ||||||||  ||  |||||    
4267941 tcttaaaaatcgtggttgggcctaacacaatccaaaaaaaaactagcttttgaggtgaggattgcccccacttataaacaaattgtcagaccaactccta 4267842  T
327 tccgatgtgggactcttaacac 348  Q
     |||||||||||||||||||||    
4267841 accgatgtgggactcttaacac 4267820  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #60
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 229 - 347
Target Start/End: Complemental strand, 28080749 - 28080632
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| ||||||||  |||||| ||||||| ||||||| ||| |||  |||  |||||||  ||||||||||||||||||||||||| || ||||    
28080749 tcttagaaatcgtggttggatctaacataaccccacaaaaccgacttgtgaagtgaaaattgccct-acttataaacacattgtcaggtcatctcttatc 28080651  T
329 cgatgtgggactcttaaca 347  Q
    ||||||| |||||||||||    
28080650 cgatgtgagactcttaaca 28080632  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #61
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 229 - 313
Target Start/End: Complemental strand, 6991840 - 6991756
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtc 313  Q
    |||||||||| ||||||||||||||||||||| |||||||| |||||  ||| ||||||||| | ||||||||||||| ||||||    
6991840 tcttagaaattgtggttgggcctaacacaacctcataaaactggcttaagaggtgaggattgtcgccacttataaacaaattgtc 6991756  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #62
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 229 - 357
Target Start/End: Complemental strand, 21822128 - 21821995
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgccccc----acttataaacacattgtcaggtcatgtcc 324  Q
    |||||||||| ||||||||| ||||||||| |||| |||| | |||| |||||||||||||||||||    | ||||||||||||||| | | ||| ||     
21822128 tcttagaaattgtggttgggtctaacacaaacccacaaaatctgcttgtgagatgaggattgcccccttataattataaacacattgtgacgccatctca 21822029  T
325 tatccgatgtgggactcttaacac-ccccctcac 357  Q
    |||||||||||| ||| ||||||| |||||||||    
21822028 tatccgatgtggaactgttaacacaccccctcac 21821995  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #63
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 232 - 343
Target Start/End: Original strand, 23839079 - 23839190
Alignment:
232 tagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccga 331  Q
    ||||||| || | |||||||||||||||| || ||||||||||| |||| |||||||| |||||||||||||||| ||||| ||  ||| || ||||||     
23839079 tagaaattgtcgatgggcctaacacaacctcacaaaaccggcttgtgaggtgaggatttcccccacttataaacagattgttagaccatctcttatccgt 23839178  T
332 tgtgggactctt 343  Q
    |||| |||||||    
23839179 tgtgagactctt 23839190  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #64
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 229 - 320
Target Start/End: Original strand, 43075309 - 43075400
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcat 320  Q
    |||||||||| ||||||| ||  |||||||||||| ||||||  ||| |||| |||||||||||||||||||||||||| |||||| |||||    
43075309 tcttagaaatcgtggttgagctcaacacaaccccacaaaaccaacttgtgaggtgaggattgcccccacttataaacacgttgtcatgtcat 43075400  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #65
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 228 - 347
Target Start/End: Complemental strand, 5522967 - 5522846
Alignment:
228 ctcttagaaatggtggttgggcctaacacaaccccataaaa--ccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcct 325  Q
    |||||| |||| |||||||||| |||||||||| || ||||  ||||||| |||| ||| |||||| |||||||| ||||||||||||||  ||  || |    
5522967 ctcttaaaaatcgtggttgggcgtaacacaacctcacaaaataccggcttgtgaggtgaagattgctcccacttaaaaacacattgtcagaccaactctt 5522868  T
326 atccgatgtgggactcttaaca 347  Q
    || |||||||||||||||||||    
5522867 atacgatgtgggactcttaaca 5522846  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #66
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 265 - 347
Target Start/End: Original strand, 9689125 - 9689207
Alignment:
265 aaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggactcttaaca 347  Q
    ||||||||||| |||| |||||||| ||||||||||||| ||||||||||   |||  |||||||||||||||||||||||||    
9689125 aaaaccggcttgtgaggtgaggatttcccccacttataagcacattgtcaaaccatcacctatccgatgtgggactcttaaca 9689207  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #67
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 231 - 345
Target Start/End: Original strand, 31257032 - 31257146
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccg 330  Q
    |||||||| ||||||| | |||||||||||||| ||||| || || |||| ||| ||||||||||||||||||||| ||||||||  ||  | ||| |||    
31257032 ttagaaatcgtggttgagtctaacacaaccccacaaaactggtttgtgaggtgaagattgcccccacttataaacaaattgtcagaccaacttctaaccg 31257131  T
331 atgtgggactcttaa 345  Q
    ||||| |||||||||    
31257132 atgtgagactcttaa 31257146  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #68
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 229 - 299
Target Start/End: Complemental strand, 32474585 - 32474515
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccactt 299  Q
    |||||||||| ||||||||||||||| ||| |||| ||||||||||| |||| ||||||||||||||||||    
32474585 tcttagaaattgtggttgggcctaacgcaaacccacaaaaccggcttgtgaggtgaggattgcccccactt 32474515  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #69
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 229 - 347
Target Start/End: Original strand, 42985122 - 42985240
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    ||||||||||  |||||| | ||||||||||| || |||| || ||| |||| ||||||||||| |||||||||||||||||||||   |||  | ||||    
42985122 tcttagaaattatggttgagtctaacacaacctcacaaaatcgacttgtgaggtgaggattgcctccacttataaacacattgtcaaaccatcacatatc 42985221  T
329 cgatgtgggactcttaaca 347  Q
    ||||||| |||||||||||    
42985222 cgatgtgagactcttaaca 42985240  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #70
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 229 - 314
Target Start/End: Complemental strand, 4507017 - 4506932
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtca 314  Q
    |||||||||| || |||||| |||||||||||||||||||||| ||| |||| ||||||||||  | || ||||||||||||||||    
4507017 tcttagaaatcgtagttgggtctaacacaaccccataaaaccgacttgtgaggtgaggattgctgcaacgtataaacacattgtca 4506932  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #71
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 229 - 353
Target Start/End: Original strand, 9688869 - 9688993
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    ||||||||||  ||||||||  |||||||| ||||||||||| || | |||| ||||||||||  ||||| ||||| ||| ||||||  |||   |||||    
9688869 tcttagaaatcctggttgggtttaacacaatcccataaaaccagcctgtgaggtgaggattgcatccactcataaatacagtgtcagaccatcatctatc 9688968  T
329 cgatgtgggactcttaacacccccc 353  Q
    |||||||| ||||||||||||||||    
9688969 cgatgtggaactcttaacacccccc 9688993  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #72
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 228 - 348
Target Start/End: Original strand, 14540739 - 14540859
Alignment:
228 ctcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctat 327  Q
    ||||||||||| ||||||   ||||||||||  ||| ||||  ||||| |||   |||||||| ||  ||||||||||||||||||||||||| ||||||    
14540739 ctcttagaaatcgtggttaaacctaacacaattccaaaaaattggcttgtgatgagaggattgtccttacttataaacacattgtcaggtcatctcctat 14540838  T
328 ccgatgtgggactcttaacac 348  Q
    |||||||| || |||||||||    
14540839 ccgatgtgtgattcttaacac 14540859  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #73
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 229 - 309
Target Start/End: Complemental strand, 15317637 - 15317557
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacat 309  Q
    ||||||||||  ||||||||||||||||||| ||| |||||  | || |||| ||||||||||||||||||||||||||||    
15317637 tcttagaaattatggttgggcctaacacaacaccacaaaactagtttgtgaggtgaggattgcccccacttataaacacat 15317557  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #74
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 229 - 309
Target Start/End: Original strand, 40898921 - 40899001
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacat 309  Q
    |||||||| | ||| ||| ||||||||||| ||||||||||| |||| |||| ||| ||||||||||||||||||||||||    
40898921 tcttagaattcgtgattgagcctaacacaatcccataaaaccagcttgtgaggtgatgattgcccccacttataaacacat 40899001  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #75
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 240 - 343
Target Start/End: Complemental strand, 47849864 - 47849763
Alignment:
240 gtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggac 339  Q
    ||||||||||||| |||||||||| ||||| ||||| |||| |||| |||||||| |||||||||||| |  ||| ||||| |  |||||||||||||||    
47849864 gtggttgggcctagcacaaccccacaaaactggcttgtgaggtgagtattgccccaacttataaacacgt--tcatgtcatcttttatccgatgtgggac 47849767  T
340 tctt 343  Q
    ||||    
47849766 tctt 47849763  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #76
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 229 - 343
Target Start/End: Complemental strand, 1793831 - 1793719
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||| ||||| ||||||||||||  |||||||||| |||||| |||| |||| ||||||||||||||||| ||||  ||||||||||  ||| || ||||    
1793831 tcttcgaaatcgtggttgggccttgcacaaccccacaaaacctgcttgtgaggtgaggattgcccccactaataa--acattgtcagaccatctcttatc 1793734  T
329 cgatgtgggactctt 343  Q
    | ||||| |||||||    
1793733 caatgtgagactctt 1793719  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #77
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 231 - 342
Target Start/End: Original strand, 20305664 - 20305775
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccg 330  Q
    ||||||||  ||||| ||||||||||||||||| ||||   | || |||| ||||||||||||||||||||||||||||| |  |  ||| ||||||||     
20305664 ttagaaatcatggttaggcctaacacaaccccacaaaataagtttgtgaggtgaggattgcccccacttataaacacattattggaacatctcctatcca 20305763  T
331 atgtgggactct 342  Q
    ||||||||||||    
20305764 atgtgggactct 20305775  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #78
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 240 - 343
Target Start/End: Complemental strand, 47849645 - 47849542
Alignment:
240 gtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggac 339  Q
    ||||||| ||||||||||| |||| |||||||| || |||| ||||||||||||| ||||||||||||||  ||| | ||| |  |||||||||||| ||    
47849645 gtggttgagcctaacacaagcccacaaaaccgggttgtgaggtgaggattgccccaacttataaacacatgttcatgccatcttttatccgatgtggcac 47849546  T
340 tctt 343  Q
    ||||    
47849545 tctt 47849542  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #79
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 229 - 303
Target Start/End: Complemental strand, 1000634 - 1000560
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataa 303  Q
    |||||||||| ||||||||||| || ||||||||| ||||||| ||| | || ||||||||||||||||||||||    
1000634 tcttagaaatcgtggttgggccaaagacaaccccacaaaaccgtcttgtaaggtgaggattgcccccacttataa 1000560  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #80
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 229 - 307
Target Start/End: Original strand, 30727117 - 30727195
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacac 307  Q
    |||||||||| |||||||||||||||  ||||  | |||||| |||| |||| ||||||||||||||||||||||||||    
30727117 tcttagaaattgtggttgggcctaacttaaccgtacaaaaccagcttgtgaggtgaggattgcccccacttataaacac 30727195  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #81
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 229 - 347
Target Start/End: Complemental strand, 41191099 - 41190981
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||  ||| |||| |||||||||| | || ||||||||||| |||  |||||||||| | |||||||||||| |||||||| | ||  | ||||    
41191099 tcttagaaactgtgattggacctaacacaatctcacaaaaccggcttgtgatgtgaggattgctctcacttataaacatattgtcagattatcacatatc 41191000  T
329 cgatgtgggactcttaaca 347  Q
     ||||||||||||||||||    
41190999 tgatgtgggactcttaaca 41190981  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #82
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 241 - 346
Target Start/End: Original strand, 26028972 - 26029077
Alignment:
241 tggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggact 340  Q
    |||||||| ||||||||||| || |||| |||||| |||| |||||||||| |||| ||| ||| | ||||||||| ||  ||||| ||||||| |||||    
26028972 tggttgggtctaacacaacctcacaaaatcggcttgtgaggtgaggattgctcccatttaaaaataaattgtcaggccaactcctaaccgatgtaggact 26029071  T
341 cttaac 346  Q
    ||||||    
26029072 cttaac 26029077  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #83
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 252 - 320
Target Start/End: Original strand, 43089230 - 43089298
Alignment:
252 aacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcat 320  Q
    |||||||||||| ||||||  ||| |||| |||||||||||||||||||||||||| |||||| |||||    
43089230 aacacaaccccacaaaaccaacttgtgaggtgaggattgcccccacttataaacacgttgtcatgtcat 43089298  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #84
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 277 - 348
Target Start/End: Original strand, 35308193 - 35308264
Alignment:
277 tgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggactcttaacac 348  Q
    |||| ||| ||||||||||||||||||||||||||||| | ||| ||||||| |||||| || |||||||||    
35308193 tgaggtgatgattgcccccacttataaacacattgtcatgacatctcctatctgatgtgagattcttaacac 35308264  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #85
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 231 - 313
Target Start/End: Complemental strand, 1794003 - 1793921
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtc 313  Q
    |||||||| ||||||||||| ||||||||| || ||||| ||||| |||| ||||| || || ||||||| ||||||||||||    
1794003 ttagaaatcgtggttgggcccaacacaaccgcacaaaactggcttgtgaggtgaggttttcctccacttacaaacacattgtc 1793921  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #86
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 265 - 315
Target Start/End: Complemental strand, 4454825 - 4454775
Alignment:
265 aaaaccggcttctgagatgaggattgcccccacttataaacacattgtcag 315  Q
    |||||||| || |||| ||||||||||||||||||||||||||||||||||    
4454825 aaaaccggtttgtgaggtgaggattgcccccacttataaacacattgtcag 4454775  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #87
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 241 - 315
Target Start/End: Original strand, 23796034 - 23796107
Alignment:
241 tggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcag 315  Q
    |||||| |||||||||| |||||||||| |||||| |||| ||||||||| |||||||||||||| | |||||||    
23796034 tggttgagcctaacacatccccataaaatcggcttgtgaggtgaggattg-ccccacttataaacccgttgtcag 23796107  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #88
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 244 - 357
Target Start/End: Complemental strand, 27939244 - 27939130
Alignment:
244 ttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggactctt 343  Q
    |||||| |||||||| |||| |||| |||||| |||| |||| |||||||| | ||||||||||||| |||  |||| |||||||  ||||||| | |||    
27939244 ttgggcataacacaatcccacaaaatcggcttatgaggtgagtattgcccctatttataaacacattttcaactcatctcctatcaaatgtgggccgctt 27939145  T
344 aacac-ccccctcac 357  Q
    ||||| |||||||||    
27939144 aacacaccccctcac 27939130  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #89
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 229 - 275
Target Start/End: Original strand, 40121923 - 40121969
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggctt 275  Q
    |||||||||| |||||||||||||||||||||||| |||||||||||    
40121923 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccggctt 40121969  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #90
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 231 - 292
Target Start/End: Complemental strand, 6782944 - 6782883
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcc 292  Q
    |||||||| ||||||| |||||||||||||||| ||||||||||| | || |||||||||||    
6782944 ttagaaatcgtggttgagcctaacacaaccccacaaaaccggcttgtaaggtgaggattgcc 6782883  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #91
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 235 - 320
Target Start/End: Original strand, 32279071 - 32279156
Alignment:
235 aaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcat 320  Q
    ||||||||||||||| ||||||| | | | ||||| ||||| | || ||||||||| || ||||||||||||||||||||| ||||    
32279071 aaatggtggttgggcataacacagctctacaaaactggcttgttaggtgaggattgtccacacttataaacacattgtcagatcat 32279156  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #92
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 228 - 309
Target Start/End: Original strand, 40898713 - 40898794
Alignment:
228 ctcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacat 309  Q
    |||||| |||| |||||||| || |||||||| ||| |||| ||| || | || ||||||||||||||||||||||||||||    
40898713 ctcttaaaaattgtggttggaccaaacacaactccacaaaatcggtttgtaaggtgaggattgcccccacttataaacacat 40898794  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #93
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 235 - 310
Target Start/End: Complemental strand, 8075938 - 8075863
Alignment:
235 aaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacatt 310  Q
    |||| |||||||| ||| ||||||| ||||||||||| ||| |||| ||| ||||  |||||||||||||||||||    
8075938 aaatcgtggttggacctgacacaactccataaaaccgacttgtgaggtgaagattatccccacttataaacacatt 8075863  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #94
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 260 - 347
Target Start/End: Complemental strand, 22574659 - 22574572
Alignment:
260 cccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggactcttaaca 347  Q
    |||| ||||||||||| |||| |||| ||||| | |||||||||||| ||| ||| | |||  | |||||||||||||||||||||||    
22574659 cccacaaaaccggcttgtgaggtgagaattgctctcacttataaacagattatcaagccatcacatatccgatgtgggactcttaaca 22574572  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #95
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 241 - 312
Target Start/End: Original strand, 23796195 - 23796266
Alignment:
241 tggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgt 312  Q
    |||||| |||||||||||||||| |||| |   || |||| ||| |||||||||||||||||||||||||||    
23796195 tggttgagcctaacacaaccccacaaaatcaatttgtgaggtgatgattgcccccacttataaacacattgt 23796266  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #96
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 241 - 343
Target Start/End: Complemental strand, 32292591 - 32292489
Alignment:
241 tggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcat-gtcctatccgatgtgggac 339  Q
    |||||||||||| |||||||||| ||| ||||||| |||| ||||||  |||||||||||||||||| |  ||||| |||  || ||||||||||| |||    
32292591 tggttgggccta-cacaaccccacaaatccggcttgtgaggtgaggaccgcccccacttataaacacttgttcaggccatactcttatccgatgtgagac 32292493  T
340 tctt 343  Q
    ||||    
32292492 tctt 32292489  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #97
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 229 - 268
Target Start/End: Complemental strand, 33834276 - 33834237
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaa 268  Q
    ||||||||||||||||||||||||||||||||||| ||||    
33834276 tcttagaaatggtggttgggcctaacacaaccccacaaaa 33834237  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #98
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 242 - 346
Target Start/End: Complemental strand, 33834490 - 33834394
Alignment:
242 ggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggactc 341  Q
    ||||||| ||||||||| |||| ||||||||||| |||| ||| ||||||||||        ||||||||||||  |||  |||||||||||||||||||    
33834490 ggttgggtctaacacaaacccacaaaaccggcttgtgaggtgaagattgccccc--------acacattgtcagaccatcacctatccgatgtgggactc 33834399  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #99
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 233 - 307
Target Start/End: Original strand, 48417518 - 48417592
Alignment:
233 agaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacac 307  Q
    |||||| |||||||||||||||||||||||| ||||| || || |||| | | |||||| | |||||||||||||    
48417518 agaaattgtggttgggcctaacacaaccccacaaaactggtttgtgaggtcaagattgctctcacttataaacac 48417592  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #100
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 231 - 344
Target Start/End: Original strand, 2315271 - 2315384
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccg 330  Q
    |||||||| ||| ||| | |||| ||||||||| ||||||||||| |||| |||| |||||| |||| |||||| |||| |||||  |||  | ||| ||    
2315271 ttagaaatcgtgattgagtctaagacaaccccacaaaaccggcttatgaggtgagaattgcctccacatataaatacatagtcagaccatcacatattcg 2315370  T
331 atgtgggactctta 344  Q
    |||||||| |||||    
2315371 atgtgggattctta 2315384  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #101
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 283 - 348
Target Start/End: Complemental strand, 33515730 - 33515665
Alignment:
283 gaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggactcttaacac 348  Q
    ||||| |||||||||||||||||||||| ||||| | | ||  |||| ||||||||||||||||||    
33515730 gaggactgcccccacttataaacacattatcaggccttatctcatccaatgtgggactcttaacac 33515665  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #102
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 233 - 357
Target Start/End: Complemental strand, 4507246 - 4507122
Alignment:
233 agaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgat 332  Q
    |||||| ||||| ||| ||||||||| || | |||||| |||| |||  ||| ||||| ||||||||||||||| |||  |||| ||| |  |||| |||    
4507246 agaaattgtggtcgggtctaacacaatcctacaaaaccagcttgtgaagtgaagattgtccccacttataaacatattagcaggccatcttgtatctgat 4507147  T
333 gtgggactcttaacacccccctcac 357  Q
    ||| |||||||||||| | ||||||    
4507146 gtgagactcttaacacactcctcac 4507122  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #103
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 240 - 304
Target Start/End: Original strand, 40991754 - 40991818
Alignment:
240 gtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaa 304  Q
    ||||||| | ||||||||||| || |||||| | || ||||||||||||| ||||||||||||||    
40991754 gtggttgagtctaacacaacctcacaaaaccagattgtgagatgaggattacccccacttataaa 40991818  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #104
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 228 - 275
Target Start/End: Original strand, 7786252 - 7786299
Alignment:
228 ctcttagaaatggtggttgggcctaacacaaccccataaaaccggctt 275  Q
    |||||||||||  ||||||||||||||||||||||| |||||| ||||    
7786252 ctcttagaaatcatggttgggcctaacacaaccccacaaaaccagctt 7786299  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #105
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 229 - 263
Target Start/End: Original strand, 10882238 - 10882272
Alignment:
229 tcttagaaatggtggttgggcctaacacaacccca 263  Q
    |||||||||| ||||||||||||||||||||||||    
10882238 tcttagaaatcgtggttgggcctaacacaacccca 10882272  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #106
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 231 - 309
Target Start/End: Original strand, 22339604 - 22339682
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacat 309  Q
    |||||||| || ||||||||||||||||||  |  |||||||||| |||| | ||||||| ||| |||||| |||||||    
22339604 ttagaaattgtcgttgggcctaacacaacctaaataaaccggcttgtgaggttaggattgtcccaacttatgaacacat 22339682  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #107
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 240 - 306
Target Start/End: Complemental strand, 49117327 - 49117261
Alignment:
240 gtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaaca 306  Q
    ||||||| |||||||| | ||||| |||| |||||| |||| |||||| ||||| ||||||||||||    
49117327 gtggttgagcctaacatagccccagaaaagcggcttgtgaggtgaggactgccctcacttataaaca 49117261  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #108
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 286 - 343
Target Start/End: Complemental strand, 7545790 - 7545734
Alignment:
286 gattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggactctt 343  Q
    ||||||||||| |||||| |||||||||||| ||| || |||||||||| ||||||||    
7545790 gattgcccccatttataagcacattgtcagg-catctcttatccgatgttggactctt 7545734  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #109
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 235 - 348
Target Start/End: Original strand, 14742830 - 14742943
Alignment:
235 aaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgt 334  Q
    |||| |||||||  ||||||||||| ||| ||||| | ||| | | ||||||||||| || || ||||||||||| |  |  |||| ||||||| ||||     
14742830 aaatcgtggttgatcctaacacaactccacaaaactgacttgtaaaatgaggattgcaccaacctataaacacatcgataactcatctcctatctgatgg 14742929  T
335 gggactcttaacac 348  Q
    ||||||||||||||    
14742930 gggactcttaacac 14742943  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #110
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 229 - 306
Target Start/End: Original strand, 23794355 - 23794432
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaaca 306  Q
    ||||| |||| ||||||| ||||||| ||| |||| ||||  ||||| |||| ||||||||||| ||| |||||||||    
23794355 tcttaaaaatcgtggttgagcctaactcaatcccacaaaattggcttgtgaggtgaggattgccaccatttataaaca 23794432  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #111
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 229 - 274
Target Start/End: Original strand, 48420741 - 48420786
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggct 274  Q
    |||||||| | ||||||||||||| |||||||||| ||||||||||    
48420741 tcttagaattcgtggttgggcctagcacaaccccacaaaaccggct 48420786  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #112
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 235 - 315
Target Start/End: Complemental strand, 2401439 - 2401359
Alignment:
235 aaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcag 315  Q
    |||| ||||||| ||||||||||| | || |||| || ||| |||  ||| ||||| || |||||||||||||||||||||    
2401439 aaatcgtggttgagcctaacacaatctcacaaaatcgacttgtgaagtgaagattgtccacacttataaacacattgtcag 2401359  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #113
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 240 - 344
Target Start/End: Complemental strand, 9625487 - 9625383
Alignment:
240 gtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggac 339  Q
    |||||||| | |||| |||||||  ||||||  ||| |||| ||||||||  ||||||||||||| | ||||||||  |||  ||||||| |||||| ||    
9625487 gtggttggtcttaactcaaccccgcaaaaccaccttgtgaggtgaggattatccccacttataaatatattgtcagaccatcacctatccaatgtggaac 9625388  T
340 tctta 344  Q
    |||||    
9625387 tctta 9625383  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #114
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 293 - 345
Target Start/End: Complemental strand, 36181082 - 36181030
Alignment:
293 cccacttataaacacattgtcaggtcatgtcctatccgatgtgggactcttaa 345  Q
    |||||||||||||||||| |||| || | ||| |||| |||||||||||||||    
36181082 cccacttataaacacattttcagatcttatccaatccaatgtgggactcttaa 36181030  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #115
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 229 - 308
Target Start/End: Original strand, 44874577 - 44874657
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattg-cccccacttataaacaca 308  Q
    ||||||| || |||||| |||||||||||| ||||||||| |||||| |  | ||||||||| || |||| ||||||||||    
44874577 tcttagacattgtggtttggcctaacacaagcccataaaatcggcttgtagggtgaggattgtcctccacgtataaacaca 44874657  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 90; Significance: 2e-43; HSPs: 105)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 229 - 357
Target Start/End: Original strand, 35038193 - 35038322
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| |||||||||||||||||||||||| ||||||||||| |||| |||||||| |||||||||||||||||||||||||| |||  ||||||    
35038193 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggatttcccccacttataaacacattgtcaggccatcacctatc 35038292  T
329 cgatgtgggactcttaacac-ccccctcac 357  Q
    |||||||||||||||||||| |||||||||    
35038293 cgatgtgggactcttaacacaccccctcac 35038322  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 229 - 348
Target Start/End: Complemental strand, 16239676 - 16239557
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| ||||||||||||||||||| |||| ||||||||||| |||| ||||| ||||||||||||||||||||||||||||| |||||||||||    
16239676 tcttagaaatcgtggttgggcctaacacaatcccacaaaaccggcttgtgaggtgaggtttgcccccacttataaacacattgtcaggccatgtcctatc 16239577  T
329 cgatgtgggactcttaacac 348  Q
    ||||||| ||||||||||||    
16239576 cgatgtgagactcttaacac 16239557  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 229 - 347
Target Start/End: Original strand, 16926948 - 16927066
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| ||||||| || ||||||||||||| ||||||||||| ||||||||||||| |||||||||||||||||||||||||| ||||| |||||    
16926948 tcttagaaatcgtggttgagcttaacacaaccccacaaaaccggcttgtgagatgaggattacccccacttataaacacattgtcaggccatgttctatc 16927047  T
329 cgatgtgggactcttaaca 347  Q
    |||||||||||||||||||    
16927048 cgatgtgggactcttaaca 16927066  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 229 - 347
Target Start/End: Complemental strand, 54567977 - 54567859
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| |||||||||||||||||||||||| ||||||||||| |||| |||||||| |||||||||||||||||||||||||| |||||||||||    
54567977 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggatttcccccacttataaacacattgtcaggccatgtcctatc 54567878  T
329 cgatgtgggactcttaaca 347  Q
    |||| | ||||||||||||    
54567877 cgatataggactcttaaca 54567859  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 86; E-Value: 5e-41
Query Start/End: Original strand, 235 - 348
Target Start/End: Original strand, 20327619 - 20327732
Alignment:
235 aaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgt 334  Q
    |||| |||||||||||||||||||||||| ||||||||||| |||| ||||||||||||||||||||||| ||||||||||| |||||||||||||||||    
20327619 aaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaatacattgtcaggccatgtcctatccgatgt 20327718  T
335 gggactcttaacac 348  Q
    |||| |||||||||    
20327719 gggattcttaacac 20327732  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 84; E-Value: 8e-40
Query Start/End: Original strand, 229 - 348
Target Start/End: Complemental strand, 4155644 - 4155525
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| |||||||||||||||||||||| | ||||||||||| |||| ||||||||| ||||||||||||||||||||||||| | ||||||||     
4155644 tcttagaaatcgtggttgggcctaacacaaccctaaaaaaccggcttttgaggtgaggattgtccccacttataaacacattgtcaggccttgtcctatg 4155545  T
329 cgatgtgggactcttaacac 348  Q
    ||||||||||||||||||||    
4155544 cgatgtgggactcttaacac 4155525  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 84; E-Value: 8e-40
Query Start/End: Original strand, 229 - 348
Target Start/End: Complemental strand, 54368601 - 54368482
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| ||||||||| |||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||| ||||| ||| | |||||    
54368601 tcttagaaatcgtggttgggtctaacacaaccccataaaaccggcttgtgaggtgaggattgcccccacttataaacacattttcaggccatcttctatc 54368502  T
329 cgatgtgggactcttaacac 348  Q
     |||||||||||||||||||    
54368501 ggatgtgggactcttaacac 54368482  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 229 - 347
Target Start/End: Complemental strand, 4155409 - 4155291
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| |||||||||||||||||||||||| ||||||||||| |||| ||||||||||||||||||||||||||  |||| || |||||| ||||    
4155409 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttttgaggtgaggattgcccccacttataaacacgctgtctggccatgtcatatc 4155310  T
329 cgatgtgggactcttaaca 347  Q
    |||||||||||||||||||    
4155309 cgatgtgggactcttaaca 4155291  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 79; E-Value: 8e-37
Query Start/End: Original strand, 229 - 347
Target Start/End: Original strand, 35038427 - 35038545
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||| | |||||||||||||||||||||||| |||||| |||| | || ||||||||||||||||||||||||||||||||||| |||  ||||||    
35038427 tcttagaagtcgtggttgggcctaacacaaccccacaaaaccagcttgtcaggtgaggattgcccccacttataaacacattgtcaggccatcacctatc 35038526  T
329 cgatgtgggactcttaaca 347  Q
    |||||||||||||||||||    
35038527 cgatgtgggactcttaaca 35038545  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 229 - 357
Target Start/End: Complemental strand, 31317551 - 31317422
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| |||||||||||||||||||||||  |||| |||||| |||| ||| ||||  ||||||||||||||||||||||| |||||||||||||    
31317551 tcttagaaatcgtggttgggcctaacacaaccccgcaaaatcggcttgtgaggtgatgattttccccacttataaacacattgtcatgtcatgtcctatc 31317452  T
329 cgatgtgggactcttaacac-ccccctcac 357  Q
    |||||| ||||||||||||| |||||||||    
31317451 cgatgtaggactcttaacacaccccctcac 31317422  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 231 - 347
Target Start/End: Complemental strand, 11589868 - 11589752
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccg 330  Q
    |||||||| |||||||||||||||||||||||| ||||||||||| |||| ||||||||||||||||||||||||| ||||||||| ||  ||||| |||    
11589868 ttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcaggccaactcctaaccg 11589769  T
331 atgtgggactcttaaca 347  Q
    ||||| |||||||||||    
11589768 atgtgagactcttaaca 11589752  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 231 - 347
Target Start/End: Original strand, 20327850 - 20327966
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccg 330  Q
    ||||||||  ||||||||||||||||||||||| ||||||||||| |||| ||||||||||||||||||||||||| ||||||||| ||  ||||| |||    
20327850 ttagaaatcatggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcaggccaactcctaaccg 20327949  T
331 atgtgggactcttaaca 347  Q
    |||||||||||||||||    
20327950 atgtgggactcttaaca 20327966  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 229 - 347
Target Start/End: Original strand, 1723075 - 1723192
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| |||||||||||||||||||||||| ||||||||||| |||| ||||||||||||||||||||||||| ||||||||| ||  | ||| |    
1723075 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcaggccaact-ctaac 1723173  T
329 cgatgtgggactcttaaca 347  Q
    |||||||||||||||||||    
1723174 cgatgtgggactcttaaca 1723192  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 229 - 347
Target Start/End: Complemental strand, 22729185 - 22729067
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| ||||||||||||||||||||| || ||||||||||| |||  |||||||||||||||||| |||||||||||||||  ||| |||||||    
22729185 tcttagaaattgtggttgggcctaacacaacctcacaaaaccggcttgtgaagtgaggattgcccccacttgtaaacacattgtcagaccatctcctatc 22729086  T
329 cgatgtgggactcttaaca 347  Q
    |||||||||||||| ||||    
22729085 cgatgtgggactctgaaca 22729067  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 229 - 353
Target Start/End: Complemental strand, 8019053 - 8018929
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| |||||||||||||||||||||||| ||||||||||| |||| |||||||||| |||||||||||||| ||| ||||| ||  | ||| |    
8019053 tcttagaaattgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcacccacttataaacaaattttcaggccaacttctaac 8018954  T
329 cgatgtgggactcttaacacccccc 353  Q
    |||||||||||||||||||| ||||    
8018953 cgatgtgggactcttaacacacccc 8018929  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 229 - 348
Target Start/End: Original strand, 20303063 - 20303182
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    ||||| |||| ||||||| ||||||||||| |||| |||||||| || |||| ||||||||||||||||||||||| ||||||||||| |||||| ||||    
20303063 tcttaaaaatcgtggttgagcctaacacaatcccacaaaaccggtttgtgaggtgaggattgcccccacttataaatacattgtcaggccatgtcatatc 20303162  T
329 cgatgtgggactcttaacac 348  Q
    |||||||||| |||||||||    
20303163 cgatgtgggattcttaacac 20303182  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 229 - 348
Target Start/End: Complemental strand, 39620411 - 39620292
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| |||||||||| ||||||||||||| ||||| ||||| |||| || || || ||||||||||||||||||||||||||||||  ||||||    
39620411 tcttagaaatcgtggttgggcttaacacaaccccacaaaactggcttatgaggtgcgggttacccccacttataaacacattgtcaggtcatcacctatc 39620312  T
329 cgatgtgggactcttaacac 348  Q
    ||||||| ||||||||||||    
39620311 cgatgtgagactcttaacac 39620292  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #18
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 229 - 347
Target Start/End: Original strand, 7697397 - 7697514
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| |||||| ||||||||||||||||| |||||| |||| |||| ||| |||||||||||||||| |||| |||||| |||||| |||||||    
7697397 tcttagaaattgtggttaggcctaacacaaccccacaaaaccagcttgtgaggtgatgattgcccccacttat-aacatattgtctggtcatctcctatc 7697495  T
329 cgatgtgggactcttaaca 347  Q
    |||||||||||||||||||    
7697496 cgatgtgggactcttaaca 7697514  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #19
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 229 - 347
Target Start/End: Original strand, 12930127 - 12930245
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    ||||||||||||||||||||||||||||||||||| ||||||||||| |||  |||| |||| |||||| ||| |||||||||||||||||| || ||||    
12930127 tcttagaaatggtggttgggcctaacacaaccccacaaaaccggcttgtgaagtgagaattgtccccacatatgaacacattgtcaggtcatctcttatc 12930226  T
329 cgatgtgggactcttaaca 347  Q
    ||||||| |||| ||||||    
12930227 cgatgtgagacttttaaca 12930245  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #20
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 228 - 349
Target Start/End: Complemental strand, 18757928 - 18757807
Alignment:
228 ctcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctat 327  Q
    ||||| ||||| |||||||||||||||||||||||| ||||||| ||| |||  ||||||| |||||||||||||||||||| |||||||||  ||||||    
18757928 ctcttggaaatcgtggttgggcctaacacaaccccacaaaaccgccttgtgatgtgaggatcgcccccacttataaacacatagtcaggtcaactcctat 18757829  T
328 ccgatgtgggactcttaacacc 349  Q
    |||||||||||||  |||||||    
18757828 ccgatgtgggacttgtaacacc 18757807  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #21
Raw Score: 69; E-Value: 7e-31
Query Start/End: Original strand, 235 - 347
Target Start/End: Original strand, 6487338 - 6487450
Alignment:
235 aaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgt 334  Q
    |||| |||||||||||||| ||||||||||||||||||||| |||| |||||||| || ||||||||||||| ||||||||| ||  ||||| |||||||    
6487338 aaatcgtggttgggcctaaaacaaccccataaaaccggcttgtgaggtgaggattacctccacttataaacaaattgtcaggccaactcctaaccgatgt 6487437  T
335 gggactcttaaca 347  Q
    |||||||||||||    
6487438 gggactcttaaca 6487450  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #22
Raw Score: 69; E-Value: 7e-31
Query Start/End: Original strand, 231 - 347
Target Start/End: Complemental strand, 9273044 - 9272928
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccg 330  Q
    ||||||||||||||||||| ||||||||||||| ||||||||||| |||| ||||| ||||||||||||||||||| ||| ||||| ||  ||||| |||    
9273044 ttagaaatggtggttgggcttaacacaaccccacaaaaccggcttgtgaggtgagggttgcccccacttataaacaaattatcaggccaattcctaaccg 9272945  T
331 atgtgggactcttaaca 347  Q
    ||||| |||||||||||    
9272944 atgtgagactcttaaca 9272928  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #23
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 235 - 357
Target Start/End: Complemental strand, 9273274 - 9273151
Alignment:
235 aaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgt 334  Q
    |||||||||||| |||||||||||||||| |||||| |||| |||  ||||||||||||||||||||||||| ||||||||  ||  ||||| |||||||    
9273274 aaatggtggttgagcctaacacaaccccacaaaaccagcttgtgaagtgaggattgcccccacttataaacaaattgtcagaccaattcctaaccgatgt 9273175  T
335 gggactcttaacac-ccccctcac 357  Q
    |||||||||||||| |||||||||    
9273174 gggactcttaacacaccccctcac 9273151  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #24
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 236 - 347
Target Start/End: Original strand, 27670398 - 27670509
Alignment:
236 aatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtg 335  Q
    |||||||||||||||||||||||||||| ||||||||| | |||| |||||||||||||||||||||||||  |||||||| ||  ||||  ||||||||    
27670398 aatggtggttgggcctaacacaaccccacaaaaccggcctttgaggtgaggattgcccccacttataaacaatttgtcaggccaattcctgaccgatgtg 27670497  T
336 ggactcttaaca 347  Q
    ||||||||||||    
27670498 ggactcttaaca 27670509  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #25
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 229 - 352
Target Start/End: Complemental strand, 39269416 - 39269293
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    ||||| |||| || ||| |||||||||||| |||  ||||||||||| |||| ||||||||||||||||||||||||||||||||||  ||||| || ||    
39269416 tcttaaaaatcgtagttaggcctaacacaatccctcaaaaccggcttgtgaggtgaggattgcccccacttataaacacattgtcagaccatgtgctctc 39269317  T
329 cgatgtgggactcttaacaccccc 352  Q
    | ||||||||||||||||||||||    
39269316 caatgtgggactcttaacaccccc 39269293  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #26
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 229 - 347
Target Start/End: Complemental strand, 31317313 - 31317196
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| ||||||| ||||||||||| |||| ||||||||||| |||| ||||||||| |||||||||||||||||||| || |  ||||| ||||    
31317313 tcttagaaatcgtggttgagcctaacacaatcccacaaaaccggcttgtgaggtgaggattg-ccccacttataaacacattgccatgctatgtcttatc 31317215  T
329 cgatgtgggactcttaaca 347  Q
    |||||||||||||||||||    
31317214 cgatgtgggactcttaaca 31317196  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #27
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 229 - 357
Target Start/End: Complemental strand, 16239912 - 16239783
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| ||| |||| ||||||||||||||| ||||||| ||| |||| ||||  ||||||||||||||||||| ||||||||| |||||||||||    
16239912 tcttagaaattgtgcttggacctaacacaaccccacaaaaccgacttgtgaggtgagatttgcccccacttataaacatattgtcaggccatgtcctatc 16239813  T
329 cgatgtgggactcttaacac-ccccctcac 357  Q
    ||  ||| |||||||||||| |||||||||    
16239812 cgtcgtgtgactcttaacacaccccctcac 16239783  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #28
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 229 - 340
Target Start/End: Original strand, 45138970 - 45139081
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| ||||||||| || ||||||||||| ||||||||||| |||| |||||||||||||||||||| ||||| |||||||| ||| || ||||    
45138970 tcttagaaatcgtggttgggtcttacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttattaacacgttgtcaggccatctcttatc 45139069  T
329 cgatgtgggact 340  Q
     |||||||||||    
45139070 agatgtgggact 45139081  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #29
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 229 - 347
Target Start/End: Complemental strand, 17638319 - 17638202
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| |||||||||||||||||||||||  |||||| |||| |||| ||||||||| ||||||||||||||| ||||||||| ||  ||||| |    
17638319 tcttagaaatcgtggttgggcctaacacaacccctcaaaaccagcttgtgaggtgaggattg-ccccacttataaacaaattgtcaggccaactcctaac 17638221  T
329 cgatgtgggactcttaaca 347  Q
    |||||||| ||||||||||    
17638220 cgatgtggaactcttaaca 17638202  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #30
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 229 - 357
Target Start/End: Complemental strand, 17638490 - 17638364
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    ||||| |||| ||| |||||||||||||||||  ||||||||||||| |||||||||||||||||| ||||||||||| ||||||||| ||  | ||| |    
17638490 tcttaaaaatcgtgattgggcctaacacaacc--ataaaaccggcttgtgagatgaggattgcccc-acttataaacaaattgtcaggccagcttctaac 17638394  T
329 cgatgtgggactcttaacac-ccccctcac 357  Q
    |||||||||||||||||||| |||||||||    
17638393 cgatgtgggactcttaacacaccccctcac 17638364  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #31
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 231 - 348
Target Start/End: Original strand, 39683268 - 39683386
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccactt-ataaacacattgtcaggtcatgtcctatcc 329  Q
    |||||||| ||||||| |||||| |||| |||| ||||||| ||| |||| ||||||||||| |||||| |||||||||||||||||||||   ||||||    
39683268 ttagaaatcgtggttgagcctaatacaatcccacaaaaccgtcttgtgaggtgaggattgcctccactttataaacacattgtcaggtcatcatctatcc 39683367  T
330 gatgtgggactcttaacac 348  Q
    |||||||||||||||||||    
39683368 gatgtgggactcttaacac 39683386  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #32
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 238 - 347
Target Start/End: Original strand, 38791458 - 38791567
Alignment:
238 tggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtggg 337  Q
    |||||||||||||||||||||||||| |||| ||  || |||| ||||||||| || |||||||||| ||||||||||  ||| ||||||||||||||||    
38791458 tggtggttgggcctaacacaaccccacaaaatcgatttgtgaggtgaggattgtcctcacttataaatacattgtcagaccatctcctatccgatgtggg 38791557  T
338 actcttaaca 347  Q
    ||||||||||    
38791558 actcttaaca 38791567  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #33
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 228 - 343
Target Start/End: Original strand, 472058 - 472180
Alignment:
228 ctcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcat------- 320  Q
    ||||| ||||| |||||| ||||||||||||||||| ||||||||||| |||| | ||||||||||||||||||||||||||||||| | |||           
472058 ctctttgaaatcgtggtttggcctaacacaaccccacaaaaccggcttgtgaggtaaggattgcccccacttataaacacattgtcaagccatctcctaa 472157  T
321 gtcctatccgatgtgggactctt 343  Q
    |||||||||||||||||||||||    
472158 gtcctatccgatgtgggactctt 472180  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #34
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 228 - 339
Target Start/End: Original strand, 45138800 - 45138911
Alignment:
228 ctcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctat 327  Q
    |||| |||||| ||||||||| || | ||||||||| ||||||||||| |||| |||||||||||||||||||||||||||||| |||  ||| || |||    
45138800 ctctaagaaatcgtggttgggtctcatacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacacattgccagaccatctcttat 45138899  T
328 ccgatgtgggac 339  Q
    ||||||||||||    
45138900 ccgatgtgggac 45138911  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #35
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 228 - 347
Target Start/End: Complemental strand, 34610647 - 34610527
Alignment:
228 ctcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgc-ccccacttataaacacattgtcaggtcatgtccta 326  Q
    ||||||||||| ||||||||| |||||||||||||| ||||||| ||| |||| |||||||||| ||||||||||||||| ||||||||| ||  || |     
34610647 ctcttagaaattgtggttgggtctaacacaaccccacaaaaccgacttgtgaggtgaggattgccccccacttataaacatattgtcaggccaactcatg 34610548  T
327 tccgatgtgggactcttaaca 347  Q
    || ||| ||||||||||||||    
34610547 tctgatatgggactcttaaca 34610527  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #36
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 229 - 335
Target Start/End: Original strand, 50083079 - 50083186
Alignment:
229 tcttagaaatggtggttgggcctaacacaacccc-ataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctat 327  Q
    ||||||||||  |||||||||||||||||||||| | ||||||||||| |||| |||||||| ||||||||||||||||||||||| || |||  | |||    
50083079 tcttagaaatcatggttgggcctaacacaacccccacaaaaccggcttgtgaggtgaggatttcccccacttataaacacattgtcgggccatcacttat 50083178  T
328 ccgatgtg 335  Q
    ||||||||    
50083179 ccgatgtg 50083186  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #37
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 231 - 309
Target Start/End: Original strand, 13574922 - 13575000
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacat 309  Q
    |||||||| |||||||||||||||||||||||| ||||| ||||| |||| |||||||| |||||||||||||||||||    
13574922 ttagaaattgtggttgggcctaacacaaccccacaaaactggcttgtgaggtgaggatttcccccacttataaacacat 13575000  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #38
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 254 - 348
Target Start/End: Original strand, 23691216 - 23691310
Alignment:
254 cacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggactcttaacac 348  Q
    ||||||| || ||||||||||| |||| ||||||||||||||||||||||||| |||||||||  |  ||||| |||||||||||||||||||||    
23691216 cacaacctcacaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcaggctaactcctaaccgatgtgggactcttaacac 23691310  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #39
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 254 - 348
Target Start/End: Original strand, 23708016 - 23708110
Alignment:
254 cacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggactcttaacac 348  Q
    ||||||| || ||||||||||| |||| ||||||||||||||||||||||||| |||||||||  |  ||||| |||||||||||||||||||||    
23708016 cacaacctcacaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcaggctaactcctaaccgatgtgggactcttaacac 23708110  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #40
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 254 - 348
Target Start/End: Original strand, 23726472 - 23726566
Alignment:
254 cacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggactcttaacac 348  Q
    ||||||| || ||||||||||| |||| ||||||||||||||||||||||||| |||||||||  |  ||||| |||||||||||||||||||||    
23726472 cacaacctcacaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcaggctaactcctaaccgatgtgggactcttaacac 23726566  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #41
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 254 - 348
Target Start/End: Original strand, 23744928 - 23745022
Alignment:
254 cacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggactcttaacac 348  Q
    ||||||| || ||||||||||| |||| ||||||||||||||||||||||||| |||||||||  |  ||||| |||||||||||||||||||||    
23744928 cacaacctcacaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcaggctaactcctaaccgatgtgggactcttaacac 23745022  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #42
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 254 - 348
Target Start/End: Original strand, 24063453 - 24063547
Alignment:
254 cacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggactcttaacac 348  Q
    ||||||| || ||||||||||| |||| ||||||||||||||||||||||||| |||||||||  |  ||||| |||||||||||||||||||||    
24063453 cacaacctcacaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcaggctaactcctaaccgatgtgggactcttaacac 24063547  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #43
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 229 - 343
Target Start/End: Original strand, 30179707 - 30179821
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    ||||| |||| |||||||||| ||||| || || | ||||| | ||| |||| |||||||| |||||||||||||||||||||||||||||| || ||||    
30179707 tcttataaatcgtggttgggcataacataatcctacaaaactgacttgtgaggtgaggattacccccacttataaacacattgtcaggtcatctcttatc 30179806  T
329 cgatgtgggactctt 343  Q
     ||||||||||||||    
30179807 tgatgtgggactctt 30179821  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #44
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 227 - 320
Target Start/End: Complemental strand, 43781670 - 43781577
Alignment:
227 tctcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcat 320  Q
    |||||||||||| |||||||||||||||||||| | | ||||||| ||| |||  ||||||||||| |||||||||||| ||||||||||||||    
43781670 tctcttagaaattgtggttgggcctaacacaactctacaaaaccgacttgtgaagtgaggattgcctccacttataaactcattgtcaggtcat 43781577  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #45
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 230 - 343
Target Start/End: Complemental strand, 45828330 - 45828217
Alignment:
230 cttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatcc 329  Q
    |||||||||  ||||||||||||||||||||||| |||||| |||| |||| ||  ||||||||||||||||||||||||  ||||| ||| |  | |||    
45828330 cttagaaatcatggttgggcctaacacaaccccacaaaacctgcttgtgaggtggagattgcccccacttataaacacatgttcaggccatcttttgtcc 45828231  T
330 gatgtgggactctt 343  Q
    ||||||||||||||    
45828230 gatgtgggactctt 45828217  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #46
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 229 - 349
Target Start/End: Original strand, 3975357 - 3975477
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| ||||||||| |||||||||  ||| |||| ||||||  ||| ||| ||||  |||||||||||||||||||||||||| ||  ||||||    
3975357 tcttagaaatagtggttgggtctaacacaattccacaaaatcggcttgagaggtgatgattatccccacttataaacacattgtcaggttatcacctatc 3975456  T
329 cgatgtgggactcttaacacc 349  Q
    ||||| | |||||||||||||    
3975457 cgatgcgtgactcttaacacc 3975477  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #47
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 229 - 348
Target Start/End: Original strand, 23708223 - 23708342
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    ||||| |||| ||| |||| |||||||||| | || ||||||||||| |||| ||||||||||||||||||||||||| ||||||||   |  ||||| |    
23708223 tcttaaaaattgtgattggacctaacacaatctcacaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcagactaactcctaac 23708322  T
329 cgatgtgggactcttaacac 348  Q
     |||||||||||||||||||    
23708323 tgatgtgggactcttaacac 23708342  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #48
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 229 - 348
Target Start/End: Original strand, 23726679 - 23726798
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    ||||| |||| ||| |||| |||||||||| | || ||||||||||| |||| ||||||||||||||||||||||||| ||||||||   |  ||||| |    
23726679 tcttaaaaattgtgattggacctaacacaatctcacaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcagactaactcctaac 23726778  T
329 cgatgtgggactcttaacac 348  Q
     |||||||||||||||||||    
23726779 tgatgtgggactcttaacac 23726798  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #49
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 229 - 348
Target Start/End: Original strand, 23745135 - 23745254
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    ||||| |||| ||| |||| |||||||||| | || ||||||||||| |||| ||||||||||||||||||||||||| ||||||||   |  ||||| |    
23745135 tcttaaaaattgtgattggacctaacacaatctcacaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcagactaactcctaac 23745234  T
329 cgatgtgggactcttaacac 348  Q
     |||||||||||||||||||    
23745235 tgatgtgggactcttaacac 23745254  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #50
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 231 - 309
Target Start/End: Original strand, 50052540 - 50052619
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattg-cccccacttataaacacat 309  Q
    |||||||| |||||||||||||||||||||||| ||||||||||| |||  ||||||||| |||||||||||||||||||    
50052540 ttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaagtgaggattgccccccacttataaacacat 50052619  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #51
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 231 - 357
Target Start/End: Original strand, 29215590 - 29215716
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccg 330  Q
    |||||||| |||||||| ||||||||| | | ||||||| ||||| ||| |||||||||||||||||||||||||| ||||||    ||| | |||||      
29215590 ttagaaatcgtggttggacctaacacagctctataaaactggcttatgatatgaggattgcccccacttataaacatattgtcgtaccatcttctatcta 29215689  T
331 atgtgggactcttaacacccccctcac 357  Q
    |||| ||||||||||||| ||||||||    
29215690 atgttggactcttaacacacccctcac 29215716  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #52
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 229 - 343
Target Start/End: Complemental strand, 41915255 - 41915142
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||| | ||||||||||||||||||| || ||||||| || || |||| ||||||||||||||||||||||||||||  ||| ||||| || | ||    
41915255 tcttagaatttgtggttgggcctaacacaaacc-ataaaactggtttgtgaggtgaggattgcccccacttataaacacatgttcatgtcatctcttttc 41915157  T
329 cgatgtgggactctt 343  Q
    | |||||||||||||    
41915156 caatgtgggactctt 41915142  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #53
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 229 - 306
Target Start/End: Complemental strand, 45828104 - 45828027
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaaca 306  Q
    |||||||||| ||||| ||||||||||||||| || ||||||||||| |||| ||||||||||||| |||||||||||    
45828104 tcttagaaattgtggtagggcctaacacaacctcacaaaaccggcttgtgaggtgaggattgccccaacttataaaca 45828027  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #54
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 235 - 348
Target Start/End: Complemental strand, 49629684 - 49629572
Alignment:
235 aaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgt 334  Q
    |||||||  ||||| |||||||||||||| |||||||| || |||| || |||||||| ||||||||||||||||| ||| | ||| |||||||| ||||    
49629684 aaatggtaattgggtctaacacaaccccacaaaaccggtttgtgaggtggggattgccgccacttataaacacattttca-gccatctcctatccaatgt 49629586  T
335 gggactcttaacac 348  Q
    || |||||||||||    
49629585 ggaactcttaacac 49629572  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #55
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 235 - 314
Target Start/End: Original strand, 13741106 - 13741186
Alignment:
235 aaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgagga-ttgcccccacttataaacacattgtca 314  Q
    |||| ||||||||| |||||||||||||| ||||||||||| |||| |||||| ||| |||||||||||||||||||||||    
13741106 aaattgtggttgggtctaacacaaccccaaaaaaccggcttgtgaggtgaggatttgtccccacttataaacacattgtca 13741186  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #56
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 231 - 347
Target Start/End: Original strand, 17001422 - 17001538
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccg 330  Q
    ||||||||  ||||||| |||||||| |||||| |||| || ||| |||| ||| ||||||||||||||||||||||||||||||   |  |||||||||    
17001422 ttagaaatcatggttggacctaacactaccccacaaaatcgccttatgaggtgatgattgcccccacttataaacacattgtcagacgaactcctatccg 17001521  T
331 atgtgggactcttaaca 347  Q
    || || |||||||||||    
17001522 atatgtgactcttaaca 17001538  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #57
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 232 - 343
Target Start/End: Original strand, 13574686 - 13574797
Alignment:
232 tagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccga 331  Q
    ||||||| |||||||||||||||||||||||| ||||||||||| |||| ||| ||| |||| ||||||||||| |||  ||| | ||| |  | |||||    
13574686 tagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgacgatcgcccgcacttataaacgcatgctcaagccatattttgtccga 13574785  T
332 tgtgggactctt 343  Q
    ||||||||||||    
13574786 tgtgggactctt 13574797  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #58
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 229 - 292
Target Start/End: Complemental strand, 24866282 - 24866219
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcc 292  Q
    |||||||||| |||||||||||||||||||||||| ||||||||||| |||| |||||||||||    
24866282 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcc 24866219  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #59
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 229 - 347
Target Start/End: Complemental strand, 27086675 - 27086554
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataa---acacattgtcaggtcatgtcct 325  Q
    ||||||||||  ||||||||||||||||||| ||| ||||||  ||| | ||||||||||||  | |||||||||   ||||||||||||| |||  |||    
27086675 tcttagaaatcatggttgggcctaacacaactccacaaaaccaacttgtaagatgaggattgtactcacttataataaacacattgtcaggccatcacct 27086576  T
326 atccgatgtgggactcttaaca 347  Q
    ||| ||||||||||||||||||    
27086575 atctgatgtgggactcttaaca 27086554  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #60
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 253 - 347
Target Start/End: Complemental strand, 2123868 - 2123774
Alignment:
253 acacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggactcttaaca 347  Q
    ||||||||| ||||||  | |||  ||| |||||||||||| |||||||||||||||| |||| ||||||||||||||| ||| |||||||||||    
2123868 acacaaccctataaaattgacttgcgaggtgaggattgccctcacttataaacacattatcagatcatgtcctatccgacgtgagactcttaaca 2123774  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #61
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 229 - 315
Target Start/End: Original strand, 24063660 - 24063746
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcag 315  Q
    ||||| |||| ||| |||| |||||||||| | || ||||||||||| |||| ||||||||||||||||||||||||| ||||||||    
24063660 tcttaaaaattgtgattggacctaacacaatctcacaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcag 24063746  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #62
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 240 - 315
Target Start/End: Complemental strand, 1800289 - 1800214
Alignment:
240 gtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcag 315  Q
    ||||||||| || ||||||||||| |||||||| || |||| ||||||||||||||||||||||| ||| ||||||    
1800289 gtggttgggtcttacacaaccccacaaaaccggtttgtgaggtgaggattgcccccacttataaatacactgtcag 1800214  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #63
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 229 - 348
Target Start/End: Complemental strand, 4008770 - 4008651
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    ||||| |||| ||||||||||||||||||| | || |||| ||||||  ||| ||| |||  |||||| ||||||||| ||||||||| |||  ||||||    
4008770 tcttaaaaatagtggttgggcctaacacaatctcacaaaatcggcttaagaggtgatgatcacccccatttataaacatattgtcaggccatcacctatc 4008671  T
329 cgatgtgggactcttaacac 348  Q
    ||||| | ||||||||||||    
4008670 cgatgcgagactcttaacac 4008651  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #64
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 288 - 347
Target Start/End: Complemental strand, 34992576 - 34992517
Alignment:
288 ttgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggactcttaaca 347  Q
    ||||||||||||||||||||||||||||  |||  |||||||||||||||||||||||||    
34992576 ttgcccccacttataaacacattgtcagaccatcacctatccgatgtgggactcttaaca 34992517  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #65
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 229 - 315
Target Start/End: Original strand, 23691423 - 23691509
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcag 315  Q
    ||||| |||| ||| |||| |||||||||| | || ||| ||||||| |||| ||||||||||||||||||||||||| ||||||||    
23691423 tcttaaaaattgtgattggacctaacacaatctcacaaatccggcttgtgaggtgaggattgcccccacttataaacaaattgtcag 23691509  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #66
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 272 - 361
Target Start/End: Complemental strand, 54368764 - 54368674
Alignment:
272 gcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggactcttaacac-ccccctcacaacc 361  Q
    |||| |||| ||||||||||| ||||||||||| ||||||||||| ||| | ||||||||||| |||||||||| || |||| ||||||||    
54368764 gcttgtgaggtgaggattgccaccacttataaatacattgtcaggccatcttctatccgatgttggactcttaatacaccccgtcacaacc 54368674  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #67
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 246 - 307
Target Start/End: Original strand, 23610387 - 23610448
Alignment:
246 gggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacac 307  Q
    |||||||||||||||||| ||||||||| | |||| |||||||| |||||||||||||||||    
23610387 gggcctaacacaaccccacaaaaccggcctgtgagttgaggattacccccacttataaacac 23610448  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #68
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 229 - 347
Target Start/End: Original strand, 28087214 - 28087336
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggatt----gcccccacttataaacacattgtcaggtcatgtcc 324  Q
    |||||||||| ||| ||||| || |||||| |||| ||||||||||| |||| ||| ||||    ||||||||||||||||| ||||| ||| ||  |||    
28087214 tcttagaaatcgtgattgggtctgacacaatcccacaaaaccggcttgtgaggtgatgattaattgcccccacttataaacaaattgttaggccaactcc 28087313  T
325 tatccgatgtgggactcttaaca 347  Q
    || |||||||| |||||||||||    
28087314 taaccgatgtgagactcttaaca 28087336  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #69
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 267 - 332
Target Start/End: Complemental strand, 30138111 - 30138046
Alignment:
267 aaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgat 332  Q
    ||||||||| |||| ||||||||||||||||||||||||||||| ||||| |||  ||||||||||    
30138111 aaccggcttatgaggtgaggattgcccccacttataaacacattatcaggccatcacctatccgat 30138046  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #70
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 267 - 332
Target Start/End: Complemental strand, 30147662 - 30147597
Alignment:
267 aaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgat 332  Q
    ||||||||| |||| ||||||||||||||||||||||||||||| ||||| |||  ||||||||||    
30147662 aaccggcttatgaggtgaggattgcccccacttataaacacattatcaggccatcacctatccgat 30147597  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #71
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 232 - 309
Target Start/End: Complemental strand, 33205547 - 33205470
Alignment:
232 tagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacat 309  Q
    ||||||| |||||||||||||||||||||||  ||||| ||||| |||| ||||||||||||  || |||||||||||    
33205547 tagaaatcgtggttgggcctaacacaaccccgcaaaactggcttgtgaggtgaggattgcccttacatataaacacat 33205470  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #72
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 231 - 292
Target Start/End: Original strand, 47702410 - 47702471
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcc 292  Q
    |||||||| |||||||||||||||||||||||| |||||| |||| | ||||||||||||||    
47702410 ttagaaatcgtggttgggcctaacacaaccccacaaaaccagcttgtaagatgaggattgcc 47702471  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #73
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 229 - 309
Target Start/End: Original strand, 2806285 - 2806365
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacat 309  Q
    |||||||||| ||| | |||||||||| ||||||| ||||| ||||| |||| |||||||| | |||||||||||||||||    
2806285 tcttagaaattgtgttggggcctaacaaaaccccacaaaactggcttgtgaggtgaggattccacccacttataaacacat 2806365  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #74
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 229 - 345
Target Start/End: Original strand, 21809146 - 21809262
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| ||| ||| || |||||||| || | ||||||||||| |||| || |||||||||||||||||||  | ||||||||  |||   |||||    
21809146 tcttagaaatcgtgtttgagcttaacacaatcctacaaaaccggcttgtgaggtgtggattgcccccacttataattatattgtcagaccatcagctatc 21809245  T
329 cgatgtgggactcttaa 345  Q
    |||||||| ||||||||    
21809246 cgatgtggcactcttaa 21809262  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #75
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 229 - 345
Target Start/End: Original strand, 29575889 - 29576005
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    ||||| |||| ||||||||  ||||||||||| ||  |||||| ||| |||  |||  |||| || |||||||||||||||| ||||||||| || ||||    
29575889 tcttaaaaattgtggttggatctaacacaacctcagcaaaccgacttgtgatgtgataattgtcctcacttataaacacattctcaggtcatctcttatc 29575988  T
329 cgatgtgggactcttaa 345  Q
    ||||||| |||||||||    
29575989 cgatgtgagactcttaa 29576005  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #76
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 290 - 357
Target Start/End: Original strand, 19954278 - 19954345
Alignment:
290 gcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggactcttaacacccccctcac 357  Q
    ||||| ||||||||||| ||||||||  ||| ||||||  ||||||||||||||||||||||||||||    
19954278 gcccctacttataaacatattgtcagaccatctcctataagatgtgggactcttaacacccccctcac 19954345  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #77
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 231 - 343
Target Start/End: Original strand, 50052773 - 50052879
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgc-ccccacttataaacacattgtcaggtcatgtcctatcc 329  Q
    |||||||| |||||||||||||||||||       |||||||||| ||||  ||||||||| |||||||||||||||||| |||||| ||| |  | |||    
50052773 ttagaaatagtggttgggcctaacacaa-------aaaccggcttgtgaggcgaggattgcaccccacttataaacacatggtcaggccatattttgtcc 50052865  T
330 gatgtgggactctt 343  Q
    ||||||||||||||    
50052866 gatgtgggactctt 50052879  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #78
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 306 - 347
Target Start/End: Complemental strand, 20303054 - 20303013
Alignment:
306 acattgtcaggtcatgtcctatccgatgtgggactcttaaca 347  Q
    ||||||||||| ||||||||||||||||||||||||||||||    
20303054 acattgtcaggccatgtcctatccgatgtgggactcttaaca 20303013  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #79
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 253 - 309
Target Start/End: Complemental strand, 50930763 - 50930707
Alignment:
253 acacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacat 309  Q
    ||||||||||| |||||||  || |||| ||||||||||||||||||||||||||||    
50930763 acacaaccccacaaaaccgttttgtgaggtgaggattgcccccacttataaacacat 50930707  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #80
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 231 - 290
Target Start/End: Complemental strand, 11590088 - 11590029
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattg 290  Q
    |||||| | |||||||||||||| |||| |||||||||||||||| |||| |||||||||    
11590088 ttagaagttgtggttgggcctaatacaatcccataaaaccggcttgtgaggtgaggattg 11590029  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #81
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 277 - 359
Target Start/End: Original strand, 26753333 - 26753416
Alignment:
277 tgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggactcttaacac-ccccctcacaa 359  Q
    |||| |||||||||| |||| |||||| |||||||||| ||||||| || | |||||||  ||||||||||| |||||||||||    
26753333 tgaggtgaggattgctcccatttataagcacattgtcatgtcatgttctgtgcgatgtgatactcttaacacaccccctcacaa 26753416  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #82
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 277 - 348
Target Start/End: Original strand, 52724033 - 52724104
Alignment:
277 tgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggactcttaacac 348  Q
    |||| ||||||||||||| | ||||||||| ||||| || | || | |||||||||||||||||||||||||    
52724033 tgaggtgaggattgccccaatttataaacatattgttagattatcttctatccgatgtgggactcttaacac 52724104  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #83
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 242 - 296
Target Start/End: Complemental strand, 14611248 - 14611194
Alignment:
242 ggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgccccca 296  Q
    |||||||||||||||||| |||  |||||||||| |||| |||||||||||||||    
14611248 ggttgggcctaacacaactccactaaaccggcttgtgaggtgaggattgccccca 14611194  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #84
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 231 - 281
Target Start/End: Original strand, 20303386 - 20303436
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgaga 281  Q
    |||||||| |||||||| ||||||||||||||| ||||||||||| |||||    
20303386 ttagaaattgtggttggacctaacacaaccccacaaaaccggcttgtgaga 20303436  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #85
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 240 - 306
Target Start/End: Complemental strand, 20479082 - 20479016
Alignment:
240 gtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaaca 306  Q
    ||||||||||||| ||| ||| || |||| |||||| |||| |||||||| ||||||||||||||||    
20479082 gtggttgggcctatcaccacctcacaaaaacggcttgtgaggtgaggatttcccccacttataaaca 20479016  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #86
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 227 - 315
Target Start/End: Original strand, 37246664 - 37246749
Alignment:
227 tctcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcag 315  Q
    |||||||||||| |||||||| ||||||||||  |||||||| ||| || |||| |||||||   ||||||||||||| ||| ||||||    
37246664 tctcttagaaatcgtggttggacctaacacaattccataaaatcggtttgtgaggtgaggat---ccccacttataaatacactgtcag 37246749  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #87
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 229 - 314
Target Start/End: Original strand, 8142407 - 8142491
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtca 314  Q
    |||||||||| ||| ||||||||| ||||||| || ||||||||||| |||| ||||||||||| | | ||||||| | |||||||    
8142407 tcttagaaatcgtgattgggccta-cacaacctcacaaaaccggcttgtgaggtgaggattgcctctatttataaatatattgtca 8142491  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #88
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 296 - 344
Target Start/End: Complemental strand, 52994796 - 52994748
Alignment:
296 acttataaacacattgtcaggtcatgtcctatccgatgtgggactctta 344  Q
    |||||||||||||||||||| ||||||||||| ||||||| ||| ||||    
52994796 acttataaacacattgtcagatcatgtcctattcgatgtgagacactta 52994748  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #89
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 229 - 348
Target Start/End: Original strand, 8142646 - 8142765
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| |||||| | ||||||||||||||| |||||||  || | ||  ||| ||| |||| | ||||||||| |||||||| |||| ||  |||    
8142646 tcttagaaatcgtggttagacctaacacaaccccacaaaaccgatttgtaaggcgagaattacccctatttataaacatattgtcagatcatctcacatc 8142745  T
329 cgatgtgggactcttaacac 348  Q
    |||| |  ||||||||||||    
8142746 cgatataagactcttaacac 8142765  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #90
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 254 - 309
Target Start/End: Original strand, 15019302 - 15019357
Alignment:
254 cacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacat 309  Q
    |||||||||||||||||||||| |||| ||  ||||| | ||||||||||||||||    
15019302 cacaaccccataaaaccggcttatgaggtggtgattgtctccacttataaacacat 15019357  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #91
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 281 - 316
Target Start/End: Complemental strand, 27783096 - 27783061
Alignment:
281 atgaggattgcccccacttataaacacattgtcagg 316  Q
    |||| |||||||||||||||||||||||||||||||    
27783096 atgaagattgcccccacttataaacacattgtcagg 27783061  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #92
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 229 - 280
Target Start/End: Complemental strand, 33640130 - 33640079
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgag 280  Q
    |||||||||| ||| ||||||||||||||| |||| ||||||||||| ||||    
33640130 tcttagaaattgtgattgggcctaacacaatcccacaaaaccggcttgtgag 33640079  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #93
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 357
Target Start/End: Complemental strand, 34992860 - 34992797
Alignment:
296 acttataaacacatt-gtcaggtcatgtcctatccgatgtgggactcttaacac-ccccctcac 357  Q
    ||||||||||||||| |||||  |||  |||||||||||||||||||||||||| |||||||||    
34992860 acttataaacacatttgtcagaccatcacctatccgatgtgggactcttaacacaccccctcac 34992797  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #94
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 249 - 334
Target Start/End: Complemental strand, 2805428 - 2805342
Alignment:
249 cctaacacaaccccataaaaccggcttctgagatgaggattgccccc-acttataaacacattgtcaggtcatgtcctatccgatgt 334  Q
    |||||||||| |||| ||||||  ||| |||| |||| ||||||||| ||||||||||||||||| ||  ||| || ||||||||||    
2805428 cctaacacaatcccacaaaaccaacttatgaggtgagaattgccccccacttataaacacattgttagaccatctcatatccgatgt 2805342  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #95
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 235 - 309
Target Start/End: Original strand, 8487518 - 8487591
Alignment:
235 aaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacat 309  Q
    |||| |||||||| ||||||||||| ||| || ||| |||| |||| |||||||||  |||||||||||||||||    
8487518 aaattgtggttggacctaacacaactccagaataccagcttgtgaggtgaggattg-tcccacttataaacacat 8487591  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #96
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 231 - 272
Target Start/End: Complemental strand, 1353531 - 1353490
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccgg 272  Q
    |||| ||| |||||||||||||||||||||||| ||||||||    
1353531 ttaggaatcgtggttgggcctaacacaaccccacaaaaccgg 1353490  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #97
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 283 - 312
Target Start/End: Complemental strand, 1800068 - 1800039
Alignment:
283 gaggattgcccccacttataaacacattgt 312  Q
    ||||||||||||||||||||||||||||||    
1800068 gaggattgcccccacttataaacacattgt 1800039  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #98
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 231 - 264
Target Start/End: Complemental strand, 21833431 - 21833398
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccat 264  Q
    |||||||| |||||||||||||||||||||||||    
21833431 ttagaaatcgtggttgggcctaacacaaccccat 21833398  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #99
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 229 - 290
Target Start/End: Original strand, 26272323 - 26272384
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattg 290  Q
    |||||||||| ||||||||| |||||||||||||| |||| | |||| |||| ||| |||||    
26272323 tcttagaaattgtggttgggtctaacacaaccccacaaaatcagcttgtgaggtgacgattg 26272384  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #100
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 229 - 262
Target Start/End: Complemental strand, 27086726 - 27086693
Alignment:
229 tcttagaaatggtggttgggcctaacacaacccc 262  Q
    |||||||||| |||||||||||||||||||||||    
27086726 tcttagaaatcgtggttgggcctaacacaacccc 27086693  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #101
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 235 - 288
Target Start/End: Original strand, 32215520 - 32215573
Alignment:
235 aaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggat 288  Q
    |||| |||||||||||||||||||| ||| ||||||||||| | || |||||||    
32215520 aaatcgtggttgggcctaacacaactccacaaaaccggcttgtaaggtgaggat 32215573  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #102
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 318 - 346
Target Start/End: Complemental strand, 20327592 - 20327564
Alignment:
318 catgtcctatccgatgtgggactcttaac 346  Q
    |||||||||||||||||||||||||||||    
20327592 catgtcctatccgatgtgggactcttaac 20327564  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #103
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 229 - 309
Target Start/End: Original strand, 21717348 - 21717428
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacat 309  Q
    |||||||||| ||||||||||| ||||||||| || ||||||| ||| | || |   |||| |||||||||||||| ||||    
21717348 tcttagaaattgtggttgggccgaacacaacctcacaaaaccgacttgtaaggtagagattacccccacttataaatacat 21717428  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #104
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 244 - 347
Target Start/End: Complemental strand, 35018779 - 35018678
Alignment:
244 ttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggactctt 343  Q
    ||||||||||| |||||   ||||| |||||| | || |||| |||||||||||||||||||| ||  ||| | ||| ||| |||| |||||||| ||||    
35018779 ttgggcctaactcaacct--taaaatcggcttgtaaggtgagcattgcccccacttataaacatatgttcaagccatctcccatccaatgtgggattctt 35018682  T
344 aaca 347  Q
    ||||    
35018681 aaca 35018678  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #105
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 229 - 309
Target Start/End: Complemental strand, 42420909 - 42420829
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacat 309  Q
    |||||||||| |||| | ||||| ||||||||| | ||||| || || | || ||| |||||| |||||||||||||||||    
42420909 tcttagaaatcgtggataggcctgacacaaccctacaaaactggtttgtaaggtgaagattgctcccacttataaacacat 42420829  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0692 (Bit Score: 86; Significance: 5e-41; HSPs: 2)
Name: scaffold0692
Description:

Target: scaffold0692; HSP #1
Raw Score: 86; E-Value: 5e-41
Query Start/End: Original strand, 229 - 346
Target Start/End: Original strand, 5753 - 5870
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| |||||||||||||||||||||||  ||||||||||| |||||||||||||||||||||||||||||||||||||||   ||||| ||||    
5753 tcttagaaatcgtggttgggcctaacacaaccccgcaaaaccggcttgtgagatgaggattgcccccacttataaacacattgtcagactatgtcttatc 5852  T
329 cgatgtgggactcttaac 346  Q
    ||||||||||||||||||    
5853 cgatgtgggactcttaac 5870  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0692; HSP #2
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 229 - 314
Target Start/End: Original strand, 5543 - 5628
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtca 314  Q
    ||||||||||  ||||||||||||||||||||||  ||||||||||| |||  |||||||||||||||||||||||||||||||||    
5543 tcttagaaattatggttgggcctaacacaaccccgcaaaaccggcttgtgaagtgaggattgcccccacttataaacacattgtca 5628  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0092 (Bit Score: 75; Significance: 2e-34; HSPs: 2)
Name: scaffold0092
Description:

Target: scaffold0092; HSP #1
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 229 - 347
Target Start/End: Complemental strand, 5740 - 5622
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| ||||||||| |||||||||||||| ||||||||||| | ||||||||||| |||||||||||||||||||||||| | ||| | |||||    
5740 tcttagaaatcgtggttgggtctaacacaaccccacaaaaccggcttgtaagatgaggattacccccacttataaacacattgtcatgccatcttctatc 5641  T
329 cgatgtgggactcttaaca 347  Q
     ||||||||||||||||||    
5640 tgatgtgggactcttaaca 5622  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0092; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 229 - 357
Target Start/End: Complemental strand, 5975 - 5847
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| || ||||| ||||||||||||  | |||| ||||||   || ||||||||| || |||||||||||| ||||||| | ||| | |||||    
5975 tcttagaaatcgtagttggacctaacacaacctaacaaaatcggcttgaaaggtgaggattgtcctcacttataaacatattgtcatgccatcttctatc 5876  T
329 cgatgtgggactcttaacacccccctcac 357  Q
    |||||||| ||| ||||||| ||||||||    
5875 cgatgtggaactgttaacacacccctcac 5847  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0334 (Bit Score: 74; Significance: 7e-34; HSPs: 1)
Name: scaffold0334
Description:

Target: scaffold0334; HSP #1
Raw Score: 74; E-Value: 7e-34
Query Start/End: Original strand, 232 - 357
Target Start/End: Original strand, 4431 - 4556
Alignment:
232 tagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccga 331  Q
    |||||||  |||||| |||||||||||||||| ||||||||||| |||| ||||||||||||||||||||||||| ||||||||| ||  ||||| | ||    
4431 tagaaatcatggttgagcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcaggccaactcctaactga 4530  T
332 tgtgggactcttaacacccccctcac 357  Q
    ||||| ||||||||||||||||||||    
4531 tgtggcactcttaacacccccctcac 4556  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0766 (Bit Score: 73; Significance: 3e-33; HSPs: 2)
Name: scaffold0766
Description:

Target: scaffold0766; HSP #1
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 228 - 348
Target Start/End: Complemental strand, 6360 - 6240
Alignment:
228 ctcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctat 327  Q
    |||| |||||| |||||||||||||||||||||||| |||| |||||| |||| ||||||||||||||||||||||||||||||||||   || || |||    
6360 ctctaagaaatcgtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgaggattgcccccacttataaacacattgtcagactatctcttat 6261  T
328 ccgatgtgggactcttaacac 348  Q
    | |||||||||||||||||||    
6260 ctgatgtgggactcttaacac 6240  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0766; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 228 - 260
Target Start/End: Complemental strand, 6425 - 6393
Alignment:
228 ctcttagaaatggtggttgggcctaacacaacc 260  Q
    ||||||||||| |||||||||||||||||||||    
6425 ctcttagaaatcgtggttgggcctaacacaacc 6393  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0005 (Bit Score: 69; Significance: 7e-31; HSPs: 2)
Name: scaffold0005
Description:

Target: scaffold0005; HSP #1
Raw Score: 69; E-Value: 7e-31
Query Start/End: Original strand, 231 - 347
Target Start/End: Complemental strand, 56542 - 56426
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccg 330  Q
    |||||||| |||||||||||||||||||||||| ||||||||||| |||| ||| |||||||| || ||||||||| |||||||| |||  ||||| |||    
56542 ttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgatgattgcccacagttataaacaaattgtcagatcaactcctaaccg 56443  T
331 atgtgggactcttaaca 347  Q
    |||||||||||||||||    
56442 atgtgggactcttaaca 56426  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0005; HSP #2
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 228 - 343
Target Start/End: Original strand, 288655 - 288770
Alignment:
228 ctcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctat 327  Q
    |||||||||||  ||||||||||||||||||| ||| |||||| |||| |||| |||||||||| ||||  |||||| ||||||||||  ||| ||||||    
288655 ctcttagaaatcatggttgggcctaacacaactccacaaaaccagcttgtgaggtgaggattgcgcccagatataaatacattgtcagaccatctcctat 288754  T
328 ccgatgtgggactctt 343  Q
    ||||||||||||||||    
288755 ccgatgtgggactctt 288770  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0048 (Bit Score: 67; Significance: 1e-29; HSPs: 2)
Name: scaffold0048
Description:

Target: scaffold0048; HSP #1
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 229 - 347
Target Start/End: Complemental strand, 81927 - 81809
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| |||||||||||||||||||||||| ||||||| ||| | || |||  |||| ||||||||||||||| ||||||||| ||||| || ||    
81927 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccgacttgtaaggtgaaaattgtccccacttataaacatattgtcaggccatgttctgtc 81828  T
329 cgatgtgggactcttaaca 347  Q
    |||||||||||||||||||    
81827 cgatgtgggactcttaaca 81809  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0048; HSP #2
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 228 - 357
Target Start/End: Complemental strand, 82162 - 82032
Alignment:
228 ctcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctat 327  Q
    ||||||||||| |||||||||||||||||||||||| |||||||| || | |  |||||||| |||||| ||||| ||||||||||||| |||||| | |    
82162 ctcttagaaattgtggttgggcctaacacaaccccacaaaaccggtttgtaatttgaggatttcccccatttatatacacattgtcaggccatgtcatgt 82063  T
328 ccgatgtgggactcttaacac-ccccctcac 357  Q
    | ||||||||||||||||||| |||||||||    
82062 ctgatgtgggactcttaacacaccccctcac 82032  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0481 (Bit Score: 66; Significance: 4e-29; HSPs: 2)
Name: scaffold0481
Description:

Target: scaffold0481; HSP #1
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 231 - 348
Target Start/End: Original strand, 3472 - 3589
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccg 330  Q
    |||||||| ||| ||||| |||||||||||||| ||||||||||| |||| ||| ||||| ||||||||||||||| ||||||| ||||  ||||| |||    
3472 ttagaaatcgtgattgggtctaacacaaccccacaaaaccggcttgtgaggtgaagattgtccccacttataaacaaattgtcatgtcaactcctaaccg 3571  T
331 atgtgggactcttaacac 348  Q
    ||||||||||||||||||    
3572 atgtgggactcttaacac 3589  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0481; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 231 - 358
Target Start/End: Original strand, 3241 - 3366
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccg 330  Q
    |||||||| ||||||| | ||||||||| |  | ||||||||||| |||||||||||   || ||||||||||||| ||| || || ||  |||||  ||    
3241 ttagaaatcgtggttgtgtctaacacaatcttacaaaaccggcttgtgagatgagga---cctccacttataaacaaattatctggccaactcctaatcg 3337  T
331 atgtgggactcttaacac-ccccctcaca 358  Q
    ||||| |||||||||||| ||||||||||    
3338 atgtgagactcttaacacaccccctcaca 3366  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0129 (Bit Score: 65; Significance: 2e-28; HSPs: 2)
Name: scaffold0129
Description:

Target: scaffold0129; HSP #1
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 229 - 337
Target Start/End: Complemental strand, 14388 - 14280
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||  |||||||||||||||||||||||| ||||||||||| |||| ||| ||||| ||||||||||||||||||||||||  |||  ||||||    
14388 tcttagaaaacgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgatgattgtccccacttataaacacattgtcagaccatcacctatc 14289  T
329 cgatgtggg 337  Q
    |||||||||    
14288 cgatgtggg 14280  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0129; HSP #2
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 292 - 353
Target Start/End: Complemental strand, 14560 - 14499
Alignment:
292 ccccacttataaacacattgtcaggtcatgtcctatccgatgtgggactcttaacacccccc 353  Q
    ||||||||||||||||||||||||  |||  |||||||||||||||||||||||| ||||||    
14560 ccccacttataaacacattgtcagaccatcacctatccgatgtgggactcttaacgcccccc 14499  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0050 (Bit Score: 65; Significance: 2e-28; HSPs: 1)
Name: scaffold0050
Description:

Target: scaffold0050; HSP #1
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 254 - 346
Target Start/End: Original strand, 69557 - 69649
Alignment:
254 cacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggactcttaac 346  Q
    ||||||||||||||||||| || |||| ||||||||||||||||||||||||| ||||||||| ||||| ||||||| |||||||||||||||    
69557 cacaaccccataaaaccggtttgtgaggtgaggattgcccccacttataaacagattgtcaggccatgttctatccgttgtgggactcttaac 69649  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0400 (Bit Score: 64; Significance: 7e-28; HSPs: 1)
Name: scaffold0400
Description:

Target: scaffold0400; HSP #1
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 231 - 345
Target Start/End: Complemental strand, 3928 - 3813
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgc-ccccacttataaacacattgtcaggtcatgtcctatcc 329  Q
    |||||||| ||||||| |||||||||||||||| ||||| ||||| |||| |||||||||| |||||||||| |||||||||||||| |||   ||||||    
3928 ttagaaattgtggttgtgcctaacacaaccccacaaaactggcttgtgaggtgaggattgccccccacttattaacacattgtcaggccatcagctatcc 3829  T
330 gatgtgggactcttaa 345  Q
    ||||||||||||||||    
3828 gatgtgggactcttaa 3813  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0365 (Bit Score: 64; Significance: 7e-28; HSPs: 1)
Name: scaffold0365
Description:

Target: scaffold0365; HSP #1
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 231 - 345
Target Start/End: Complemental strand, 4572 - 4457
Alignment:
231 ttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgc-ccccacttataaacacattgtcaggtcatgtcctatcc 329  Q
    |||||||| ||||||| |||||||||||||||| ||||| ||||| |||| |||||||||| |||||||||| |||||||||||||| |||   ||||||    
4572 ttagaaattgtggttgtgcctaacacaaccccacaaaactggcttgtgaggtgaggattgccccccacttattaacacattgtcaggccatcagctatcc 4473  T
330 gatgtgggactcttaa 345  Q
    ||||||||||||||||    
4472 gatgtgggactcttaa 4457  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0027 (Bit Score: 59; Significance: 6e-25; HSPs: 1)
Name: scaffold0027
Description:

Target: scaffold0027; HSP #1
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 229 - 357
Target Start/End: Complemental strand, 121639 - 121509
Alignment:
229 tcttagaaatggtggttgggcctaacacaa-ccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctat 327  Q
    ||||| |||| |||||||||| |||||||| ||||| ||||||||||| |||   |||||| ||||||||||| ||||||||||||| |||||  |||||    
121639 tcttaaaaatcgtggttgggcttaacacaaaccccacaaaaccggcttgtgatgggaggatggcccccacttacaaacacattgtcatgtcatcacctat 121540  T
328 ccgatgtgggactcttaacac-ccccctcac 357  Q
    ||||||| ||||||||||||| |||||||||    
121539 ccgatgtaggactcttaacacaccccctcac 121509  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0083 (Bit Score: 58; Significance: 3e-24; HSPs: 1)
Name: scaffold0083
Description:

Target: scaffold0083; HSP #1
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 229 - 346
Target Start/End: Complemental strand, 51321 - 51205
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    |||||||||| ||| ||| || ||||||||||||| ||||| | ||| |||| |||||||||||||||||||||||||||||||||   |||||||||||    
51321 tcttagaaattgtgattgagcataacacaaccccacaaaactgacttgtgaggtgaggattgcccccacttataaacacattgtca-aacatgtcctatc 51223  T
329 cgatgtgggactcttaac 346  Q
    | || |||||||||||||    
51222 caatatgggactcttaac 51205  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0181 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: scaffold0181
Description:

Target: scaffold0181; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 227 - 347
Target Start/End: Complemental strand, 21026 - 20906
Alignment:
227 tctcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtccta 326  Q
    |||||||||||| |||||||||| ||||||||||||| ||||||||||| |||| |||||||| ||  |||||||||| ||||||||||  ||| ||||     
21026 tctcttagaaatcgtggttgggcttaacacaaccccacaaaaccggcttgtgaggtgaggattaccttcacttataaatacattgtcagaccatctcctt 20927  T
327 tccgatgtgggactcttaaca 347  Q
     | |||||  |||||||||||    
20926 actgatgtcagactcttaaca 20906  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0060 (Bit Score: 51; Significance: 4e-20; HSPs: 1)
Name: scaffold0060
Description:

Target: scaffold0060; HSP #1
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 265 - 347
Target Start/End: Complemental strand, 20624 - 20542
Alignment:
265 aaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggactcttaaca 347  Q
    |||||| |||| | || ||||||||||||||| ||||||||||||||||||| ||| |||| |||||||||||||||||||||    
20624 aaaaccagcttgtaaggtgaggattgcccccaattataaacacattgtcaggccatatcctgtccgatgtgggactcttaaca 20542  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0047 (Bit Score: 50; Significance: 2e-19; HSPs: 2)
Name: scaffold0047
Description:

Target: scaffold0047; HSP #1
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 229 - 346
Target Start/End: Complemental strand, 12732 - 12615
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    ||||| |||| ||||||||||||||||||||| || |||| || ||| |||| |||||||||||||||| |||||| |||||||||   |||  ||||||    
12732 tcttaaaaattgtggttgggcctaacacaaccacacaaaatcgacttgtgaggtgaggattgcccccacatataaatacattgtcaaaccatcacctatc 12633  T
329 cgatgtgggactcttaac 346  Q
    |||  |||||||||||||    
12632 cgacatgggactcttaac 12615  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0047; HSP #2
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 227 - 357
Target Start/End: Complemental strand, 12973 - 12837
Alignment:
227 tctcttagaaatggtggttggg-----cctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatg 321  Q
    |||||||||||| |||||||||     | ||||||||||  |||||||||| || | ||||||||||||||||||||||||||  |||||||| | |||     
12973 tctcttagaaatcgtggttgggtctaacttaacacaacctgataaaaccggtttgtaagatgaggattgcccccacttataaattcattgtcaagccatc 12874  T
322 tcctatccgatgtgggactcttaacac-ccccctcac 357  Q
     ||||| ||||||||| |||||||||| |||||||||    
12873 acctattcgatgtggggctcttaacacaccccctcac 12837  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0001 (Bit Score: 46; Significance: 4e-17; HSPs: 1)
Name: scaffold0001
Description:

Target: scaffold0001; HSP #1
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 289 - 346
Target Start/End: Complemental strand, 429898 - 429841
Alignment:
289 tgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggactcttaac 346  Q
    |||||||||||||||||||||||||||| |||  ||||||||||||||||||||||||    
429898 tgcccccacttataaacacattgtcaggccatcacctatccgatgtgggactcttaac 429841  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0041 (Bit Score: 45; Significance: 1e-16; HSPs: 2)
Name: scaffold0041
Description:

Target: scaffold0041; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 229 - 309
Target Start/End: Complemental strand, 67363 - 67283
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacat 309  Q
    |||||||| | ||| ||| ||||||||||| ||||||||||| |||| |||| ||| ||||||||||||||||||||||||    
67363 tcttagaattcgtgattgagcctaacacaatcccataaaaccagcttgtgaggtgatgattgcccccacttataaacacat 67283  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0041; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 228 - 309
Target Start/End: Complemental strand, 67571 - 67490
Alignment:
228 ctcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacat 309  Q
    |||||| |||| |||||||| || |||||||| ||| |||| ||| || | || ||||||||||||||||||||||||||||    
67571 ctcttaaaaattgtggttggaccaaacacaactccacaaaatcggtttgtaaggtgaggattgcccccacttataaacacat 67490  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0024 (Bit Score: 44; Significance: 6e-16; HSPs: 1)
Name: scaffold0024
Description:

Target: scaffold0024; HSP #1
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 229 - 348
Target Start/End: Original strand, 89552 - 89671
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatc 328  Q
    ||||| |||| |||||||| |||||||||||| || ||||||| ||| | || |||  |||| ||||||||||||||| ||| |||| |||| || ||||    
89552 tcttaaaaattgtggttggacctaacacaacctcacaaaaccgacttgtaaggtgaatattgtccccacttataaacatattatcagatcatatcttatc 89651  T
329 cgatgtgggactcttaacac 348  Q
    ||||  ||||||||||||||    
89652 cgatcggggactcttaacac 89671  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0729 (Bit Score: 37; Significance: 0.000000000009; HSPs: 2)
Name: scaffold0729
Description:

Target: scaffold0729; HSP #1
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 265 - 347
Target Start/End: Complemental strand, 2560 - 2476
Alignment:
265 aaaaccggcttctgagatgaggattgcccccactt-ata-aacacattgtcaggtcatgtcctatccgatgtgggactcttaaca 347  Q
    ||||||||||| |||| ||||||||| | || ||| ||| ||| |||||||||| |||||| |||||||||||||||||||||||    
2560 aaaaccggcttgtgaggtgaggattgtctcctctttatanaactcattgtcaggccatgtcatatccgatgtgggactcttaaca 2476  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0729; HSP #2
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 298 - 357
Target Start/End: Complemental strand, 2745 - 2685
Alignment:
298 ttataaacacattgtcaggtcatgtcctatccgatgtgggactcttaacac-ccccctcac 357  Q
    ||||||| | ||||||||  ||||||||||||||||||||||||||||||| |||||||||    
2745 ttataaatatattgtcagaccatgtcctatccgatgtgggactcttaacacaccccctcac 2685  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0003 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: scaffold0003
Description:

Target: scaffold0003; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 228 - 307
Target Start/End: Original strand, 347569 - 347648
Alignment:
228 ctcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacac 307  Q
    ||||||||| | || ||||||||||| ||||||||| ||||||||||| |||| | | || |||||||| ||||||||||    
347569 ctcttagaattcgtagttgggcctaatacaaccccacaaaaccggcttgtgaggtaaagactgcccccaattataaacac 347648  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1034 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold1034
Description:

Target: scaffold1034; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 286 - 347
Target Start/End: Complemental strand, 3264 - 3203
Alignment:
286 gattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggactcttaaca 347  Q
    ||||||||||||||||||||| || || ||| ||  ||||| ||||||| ||||||||||||    
3264 gattgcccccacttataaacaaatagtaaggccaactcctaaccgatgtaggactcttaaca 3203  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0459 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: scaffold0459
Description:

Target: scaffold0459; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 277 - 353
Target Start/End: Complemental strand, 13370 - 13294
Alignment:
277 tgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggactcttaacacccccc 353  Q
    |||| |||||||||| | |||||| |||||||||||||||  ||  ||||| ||||||  |||||||||||| ||||    
13370 tgaggtgaggattgcactcacttacaaacacattgtcaggctatcacctattcgatgtatgactcttaacacacccc 13294  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0366 (Bit Score: 29; Significance: 0.0000005; HSPs: 2)
Name: scaffold0366
Description:

Target: scaffold0366; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 277 - 353
Target Start/End: Complemental strand, 11011 - 10935
Alignment:
277 tgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggactcttaacacccccc 353  Q
    |||| |||||||||| | |||||| |||||||||||||||  ||  ||||| ||||||  |||||||||||| ||||    
11011 tgaggtgaggattgcactcacttacaaacacattgtcaggctatcacctattcgatgtatgactcttaacacacccc 10935  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0366; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 277 - 353
Target Start/End: Complemental strand, 14677 - 14601
Alignment:
277 tgagatgaggattgcccccacttataaacacattgtcaggtcatgtcctatccgatgtgggactcttaacacccccc 353  Q
    |||| |||||||||| | |||||| |||||||||||||||  ||  ||||| ||||||  |||||||||||| ||||    
14677 tgaggtgaggattgcactcacttacaaacacattgtcaggctatcacctattcgatgtatgactcttaacacacccc 14601  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0045 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: scaffold0045
Description:

Target: scaffold0045; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 229 - 309
Target Start/End: Original strand, 41205 - 41284
Alignment:
229 tcttagaaatggtggttgggcctaacacaaccccataaaaccggcttctgagatgaggattgcccccacttataaacacat 309  Q
    |||||||||| || |||| |||||| ||||||||| |||| ||| |  |||||| ||||||| || |||||||||||||||    
41205 tcttagaaatcgtagttgagcctaatacaaccccacaaaatcgg-tagtgagattaggattgtccacacttataaacacat 41284  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University