View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14819_high_38 (Length: 337)
Name: NF14819_high_38
Description: NF14819
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14819_high_38 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 307; Significance: 1e-173; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 307; E-Value: 1e-173
Query Start/End: Original strand, 7 - 333
Target Start/End: Complemental strand, 31262262 - 31261936
Alignment:
| Q |
7 |
ctttgtctatccaactaggtagttgaattcctgaggttgcatgtaaatgttttgttactttgtaaccggttttgggtaaaccacattttttgaagagtgt |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31262262 |
ctttgtctatccaactaggtagttgaattcctgaggtagcatgtaaatgttttgttactttgtaaccggttttgggtaaaccacattttttgaagagtgt |
31262163 |
T |
 |
| Q |
107 |
ggttttggggaacttgtttgtggcatagtttgatgaagaaggatcaaattcaaaggatttatatgcagcttcaacaaaatggccataacgaaggatttcg |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31262162 |
ggttttggggaacttgtttgtggcatagtttgatgaagaagggtcgaattcaaaggatttatatgcagcttcaacaaaatggccataacgaaggatttcg |
31262063 |
T |
 |
| Q |
207 |
gaacgaagattattgtctaatgggtctaataaaccttcccaattggtcataccttggtattctttccatcttttgttaactgtcgtagttggaaatggta |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||| |
|
|
| T |
31262062 |
gaacgaagattattgtctaatgggtctaataaaccttcccaattggtcataccttggtattctttccatcttttgttaacttttgtagttggaaatggta |
31261963 |
T |
 |
| Q |
307 |
atggtgaaaatgttgattttgatgatg |
333 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
31261962 |
atggtgaaaatgttgattttgatgatg |
31261936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 144 - 205
Target Start/End: Complemental strand, 31304197 - 31304136
Alignment:
| Q |
144 |
gaaggatcaaattcaaaggatttatatgcagcttcaacaaaatggccataacgaaggatttc |
205 |
Q |
| |
|
||||||||||| ||||| |||||||| | ||||||||||||||||||||| || |||||||| |
|
|
| T |
31304197 |
gaaggatcaaactcaaatgatttatacgtagcttcaacaaaatggccatagcgtaggatttc |
31304136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University