View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14819_high_68 (Length: 268)
Name: NF14819_high_68
Description: NF14819
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14819_high_68 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 153; Significance: 4e-81; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 11 - 262
Target Start/End: Complemental strand, 609514 - 609281
Alignment:
| Q |
11 |
gaaagttgagagtgaagtgaaaatggagaggtatgagaggggaagtagaagaaggagatgcaaagaaggtaaacatgaaaacaatgaaaggttgggaaat |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
609514 |
gaaagttgagagtgaagtgaaaatggagaggtatgagaggggaagtagaagaaggagatgcaaagaaggtaaacatgaaaacaatgaaaggttgggaaat |
609415 |
T |
 |
| Q |
111 |
tggggtaaacctctttggcttgcattggcaacttcttggaaactctcatttggatctttgtctctctatctattatttaacaatgatcatgtaaaacaan |
210 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
609414 |
tggggtgaacctctttggcttgcattggcaacttcttgaaaactctcatttg------------------aattatttaacaatgatcatgtaaaacaat |
609333 |
T |
 |
| Q |
211 |
nnnnnnnagaatttttaggtatctgttctttttcttctgaatatcccctttg |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
609332 |
tttttttagaatttttaggtatctgttctttttcttctgaatatcccttttg |
609281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University