View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14819_high_69 (Length: 259)
Name: NF14819_high_69
Description: NF14819
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14819_high_69 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 110; Significance: 2e-55; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 46 - 159
Target Start/End: Complemental strand, 8931475 - 8931362
Alignment:
| Q |
46 |
aaataaagataagtttggtgaaaaaagtagttttgattatgttggtgataatggtattaatgaaaaagaagaaattgtgaatggtgttggtgttgttgaa |
145 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8931475 |
aaatgaagataagtttggtgaaaaaagtagttttgattatgttggtgataatggtattaatgaaaaagaagaaattgtgaatggtgttggtgttgttgaa |
8931376 |
T |
 |
| Q |
146 |
ggtattgggaatga |
159 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
8931375 |
ggtattgggaatga |
8931362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University