View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14819_high_86 (Length: 236)
Name: NF14819_high_86
Description: NF14819
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14819_high_86 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 18 - 221
Target Start/End: Complemental strand, 47579894 - 47579685
Alignment:
| Q |
18 |
taaagaaggccgtggaaggaaatattcca------tttccattgcatacaacgtagtctttactgttatgattcgtgttttagattttacacaagtagaa |
111 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||| |
|
|
| T |
47579894 |
taaagaaggccgtggaaggaaatattccaattccatttccattgcatacaacgtagtctttactgttatgactcgtgttttagattttacacaagaagaa |
47579795 |
T |
 |
| Q |
112 |
accattgttggggatcagggtatttctacaaattgtgagtaaaatacacaataatcaagcaacttttattatgaagctaaatttagttattaaacttaca |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47579794 |
accattgttggggatcagggtatttctacaaattgtgagtaaaatacacaataatcaagcaacttttattatgaagctaaatttagttattaaacttaca |
47579695 |
T |
 |
| Q |
212 |
tacgattcat |
221 |
Q |
| |
|
|||||||||| |
|
|
| T |
47579694 |
tacgattcat |
47579685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University