View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14819_high_90 (Length: 227)
Name: NF14819_high_90
Description: NF14819
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14819_high_90 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 105; Significance: 1e-52; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 67 - 187
Target Start/End: Complemental strand, 28286673 - 28286554
Alignment:
| Q |
67 |
attggctaaaacaattctttttaaaaaatttgaaaggaaaaaggttatgtaattcataaaaatgaatcaagaatattaagtgagatcttggttgaaatta |
166 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28286673 |
attggctaaaacaattctttttaaaatttttgaaaggaaaa-ggttatgtaattcataaaaatgaatcaagaatattaagtgagatcttggttgaaatta |
28286575 |
T |
 |
| Q |
167 |
aaaattgacttgaaagcaaat |
187 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
28286574 |
aaaattgacttgaaagcaaat |
28286554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University