View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14819_high_93 (Length: 221)
Name: NF14819_high_93
Description: NF14819
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14819_high_93 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 83; Significance: 2e-39; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 28 - 114
Target Start/End: Original strand, 32326044 - 32326130
Alignment:
| Q |
28 |
ggttcaaatcatagaagccttgaaacatctctaaataatcttctaatacattacgatcctttttgtatatgcggaaacgatttagtg |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32326044 |
ggttcaaatcatagaagccttgaaacatctctaaataatcttctaatatattacgatcctttttgtatatgcggaaacgatttagtg |
32326130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 163 - 202
Target Start/End: Original strand, 32326181 - 32326220
Alignment:
| Q |
163 |
ttgttgaggaatatttagagatgttttaactccccgcatg |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32326181 |
ttgttgaggaatatttagagatgttttaactccccgcatg |
32326220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University