View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14819_high_98 (Length: 209)
Name: NF14819_high_98
Description: NF14819
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14819_high_98 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 1 - 189
Target Start/End: Original strand, 13278418 - 13278606
Alignment:
| Q |
1 |
cgagcagagaatagggaagcaattgcttaatagaaaaactactacagccactgtcttgtcggatacataagaacgattggctgattttcacgatcaatca |
100 |
Q |
| |
|
||||| ||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
13278418 |
cgagcggagaataggtaagaaattgcttaatagaaaaactactacagccactgtcttgtcggatacataagaacgattggctgatttgcacgatcaatca |
13278517 |
T |
 |
| Q |
101 |
ttttgtttttatgttcgctacttatcggttttctttcaatccgaatttaattatgaaatagtccaaaagatgaaaaatataagaataat |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
13278518 |
ttttgtttttatgttcgctacttatcggttttctttcaatccgaatttaattataaaatagtccaaaagatgaaaaatataagaataat |
13278606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University