View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14819_low_103 (Length: 216)
Name: NF14819_low_103
Description: NF14819
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14819_low_103 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 184; Significance: 1e-100; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 184; E-Value: 1e-100
Query Start/End: Original strand, 16 - 216
Target Start/End: Original strand, 9495765 - 9495967
Alignment:
| Q |
16 |
ggtgtgaccccatcaccaaattgtaattatgact--agttttatgtctaggcggcaatgtaaattttcgaaagggctggctgttcacagcatgcaggttg |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
9495765 |
ggtgtgaccccatcaccaaattgtaattatgactctagttttatgtctaggcggcaatgtaaattttcaaaagggctggctgttcacagcatgcaggttg |
9495864 |
T |
 |
| Q |
114 |
atgcaacaactcatgatgatgaaaggaggtactctggggatacattagatttacctgaccaaataaatacacagttcacagatgaatttgacaacctcta |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9495865 |
atgcaacaactcatgatgatgaaaggaggtactctggggatacattggatttacctgaccaaataaatacacagttcacagatgaatttgacaacctcta |
9495964 |
T |
 |
| Q |
214 |
tgt |
216 |
Q |
| |
|
||| |
|
|
| T |
9495965 |
tgt |
9495967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University