View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14819_low_24 (Length: 417)
Name: NF14819_low_24
Description: NF14819
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14819_low_24 |
 |  |
|
| [»] scaffold0001 (3 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0001 (Bit Score: 86; Significance: 6e-41; HSPs: 3)
Name: scaffold0001
Description:
Target: scaffold0001; HSP #1
Raw Score: 86; E-Value: 6e-41
Query Start/End: Original strand, 272 - 401
Target Start/End: Original strand, 506910 - 507039
Alignment:
| Q |
272 |
gctgcattcatattgaaccggtctggtttgtcgaaaccgttggtttgccagttttgttcaagttgcaccagctcacgccggtttgaaagtgtagcgattc |
371 |
Q |
| |
|
||||| ||| |||||||| ||||||||||||| |||||| || |||||| |||||| ||||||||||||||||||||||||||||||| |||| ||||| |
|
|
| T |
506910 |
gctgctttcgtattgaactggtctggtttgtcaaaaccgctgatttgccggttttgaccaagttgcaccagctcacgccggtttgaaagcgtagtgattc |
507009 |
T |
 |
| Q |
372 |
attagacaattcgaaccggtcactccacag |
401 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
507010 |
attagacaattcgaaccggtcactccacag |
507039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001; HSP #2
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 114 - 173
Target Start/End: Original strand, 506755 - 506814
Alignment:
| Q |
114 |
tattataatatacatgtatcgaaatttggatcctaaattcatcaattaatcattttaaat |
173 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
506755 |
tattataatatacatggatctaaatttggatcctaaattcatcaattaatcattttaaat |
506814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001; HSP #3
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 19 - 67
Target Start/End: Original strand, 506707 - 506755
Alignment:
| Q |
19 |
caacactaaaatcaacatttcaaaattatttgtcctcattatcataatt |
67 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
506707 |
caacactaaaatcaacatttcaaaattatttgtcctcattatcaaaatt |
506755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University